Proof that Adolf Hitler was a double agent.

Proof that Adolf Hitler was a double agent.

Postby preearth » Wed May 17, 2017 1:29 am

This link provides a complete list of topics on this forum:

Proof that Adolf Hitler was a double agent.

Recently, this site (preearth.net) was taken "off-air" by an .htaccess file that "accidently materialized" in the main directory of preearth.net. On complaining, the site was restored, all except two threads on this forum; namely the threads WOW; Barack Obama is a Jew, and Hitler had Jewish roots, DNA tests show. After more complaining, these two threads were also restored. So it appears that the whole site was shut down just to censor these two threads.

Given that someone went to a lot of trouble to have, in particular, the thread Hitler had Jewish roots, DNA tests show, censored, I assumed that the information in it, was very likely correct. So, I took the idea of Hitler being a Jew, seriously, and searched the net for "Hitler was a Jew" and other such combinations. I came up with an amazing amount of evidence for this idea, and I have to say, it is convincing.

Below is a photo of a German nerve gas storage area discovered by the allies in 1945; A larger photo is here.

Image

After a bit of searching I came across these pages, which I recommend:

http://hitler-the-jew-and-the-faked-wwi ... itler.html

http://newsfromatlantis.freeforums.org/ ... -t388.html

These present facts from the second world war which show that Hitler was consciously working against the Nazis throughout the entire war. They suggest that many of the high-ranking Nazis were Jews.

In one of these pages it is stated that many of the ideas presented were from a separate source. I managed to track down what appears to be the separate source. It can be found at:

https://web.archive.org/web/20140807043 ... Hitler.htm

This article presents a picture of Hitler, and other Jews within the Nazis, deliberately making multiple "mistakes" with the intention of sabotaging the German war effort and causing the defeat of the Germans. The article states:

Hitler was a Jew, working for the Jews.

In April, 1939, Ambassador William C. Bullitt, called me to the American Embassy in Paris. The American Ambassador told me that war had been decided upon. He did not say, nor did I ask, by whom. He let me infer it... When I said that in the end Germany would be driven into the arms of Soviet Russia and Bolshevism, the Ambassador replied: "What of it? There will not be enough Germans left when the war is over to be worth bolshevising." Karl von Wiegand; reported in the Chicago Herald American, April 23, 1944.

Having the Jew Hitler run Nazi Germany had many advantages:

When Germany attacked France, Heinz Guderian made blitzkrieg come true. By disobeying orders and relentlessly driving his men and tanks as far as they could go, he wrecked havoc, far beyond the expected front line. His disregard for orders amid the fog of war, meant that the Jews in the Nazi high command were not immediately able to intervene, to prevent Guderian's quick and stunning victory.

Guderian advanced an astonishing 250 miles across enemy terrain in only eleven days. Then, on May 24, 1940, with his Panzer forces at Gravelines, only ten miles from Dunkirk, Hitler himself, ordered that the tanks were to halt. Guderian's forces were within hours of capturing more than 200,000 soldiers of the British Expeditionary Force, along with some 100,000 French soldiers. The order was received with disbelief. General von Kleist, stated that on receiving the order, "I decided to ignore it, and to push on across the canal. But then came a more emphatic order that I was to withdraw behind the canal. My tanks were kept halted there for three days."

By having Hitler order Guderian's tank divisions to sit on their hands while Dunkirk was evacuated, the Jews were able to prevent the complete and utter destruction of the trapped French and British armies, thus keeping alive the possibility of a two-front war. However, although the Jew Hitler was able to rescue some 335,000 men, all their tanks and equipment were lost.

When outraged German generals demanded to know why they were being prevented from forcing the complete surrender of the defeated armies, the Jew Hitler prattled on about his admiration for the British Empire and its importance as an essential element of world stability. Hitler did not explain why it was so important to let the hundreds of thousands of troops escape immediately, rather than say, to capture them, and later release them after having extracting various concessions. Indeed, how could he? This incident alone, should have given Hitler away as the enemy, however, the Germans, naive to such monumental deception, kept obeying orders, and in the end, it was only thought that Hitler was insane.

German aircraft had hit Allied air bases in France, Luxembourg, Belgium, and the Netherlands, destroying large numbers of planes on the ground, and crippling air defenses. Although large numbers of planes had been lost, the evacuation at Dunkirk enabled most of the British pilots, who had been based in France, to escape and fight another day. In fact, the number of planes lost, turned out to be much less important than the number of pilots, and potential pilots, that Hitler had rescued.

Although, Britain was now open and defenseless, the Jew Hitler refused to attack.

The Jew Hitler refused to even feign an attack on Britain, in order to draw the British navy to the channel, where it could be obliterated by aircraft.

So, after refusing to take out Jew controlled Britain, the Jew Hitler attacks the Soviet Union, deliberately setting up the dreaded two-front war.

Yes, to reduce the pressure for an attack on England, the Jew Hitler attacked Germany's major ally, the Soviet Union. Why attack your ally, rather than the helpless Britain? The answer is obvious.

The German attack overwhelmed the Soviets. Army Group Center achieved a stunning victory against the forces opposing it, and was positioned to strike at Moscow in the immediate future. Now that it looked like Moscow was sure to fall, the Jew Hitler single-handedly saved the city, by ordering Army Group Center to stop its advance and turn south (a decision opposed by his generals). The Jews were willing to accept any loss, to save Moscow. Once Moscow fell, the war in the East was over.

The war had gone exceedingly badly for the Soviets and there was a fear that Japan would attack from the East, at this time when the Soviet Union had no way of defending itself. It has been speculated that (the Jew) Roosevelt deliberately goaded the Japanese into war with the United States, in order to prevent this outcome.

Also, a Japanese-American war could be usefully used by the Jew Hitler as a pretext for a declaration of war against the United States and thus allow the United States to participate directly in the European theater. But how could Roosevelt be sure that Hitler would declare war?

On December 11, 1941, the Jew Hitler declared war on the United States, using the pretext of the Tripartite Pact, even though he was no more obliged to declare war on the United States than Japan was obliged to declare war on the Soviet Union, which Germany had been fighting since June 1941. Japan never declared war on the Soviet Union.

The Jew Hitler refused total mobilization of the German people, even though the munitions factories cried out for manpower and all his enemies had long since recruited woman into the work force. The Jew Hitler never bothered to use half the potential German labor force. Even though Goebbels called for total mobilization early in the war, Hitler was able to prevent this until it was too late.

On November 19, 1942, when the Soviet 5th Tank and 21st Armies launched their counter-offensive northwest of Stalingrad, the Fourth Panzer and 6th Armies were in grave danger of encirclement, unless they broke out immediately.

To ensure the 6th Army would be trapped, the Jew Hitler ordered that it should not attempt to break-out, but should hold their ground and fight to the last man. The more dead or captured Germans, the better.

The 6th Army's senior officers complained that unless they broke out immediately, their army would have to be supplied by air for weeks, if not months, which appeared to be an impossible task.

However, the Jew Hitler insisted that the Luftwaffe could sustain the Sixth Army from the air. The Luftwaffe commanders in the field, were unanimous in their belief that this was not possible. Only the Luftwaffe's commander in chief, Göring (another Jew), similarly stated that it would be possible.

When Zeitzler challenged Göring as to whether he even knew what tonnage needed to be flown in every day, Göring spat back, "I don't, but my staff officers do." Zeitzler summarized what would be necessary and Göring retorted, "I can do that." Zeitzler told him he was a liar. With this, Hitler replied "The Reichsmarschall (Göring) has made his report to me, which I have no choice but to believe."

Thus, the Jew Hitler closed the trap on the 6th Army.

To ensure the 6th Army was doomed, the Jew Hitler arranged that 250 of the vitally important Ju 52s be used to transport 81,000 German troops to Tunisia. The Tunisia campaign had little strategic value and no chance of success. But, more importantly, it ensured that the 6th Army could not be supplied by air and would thus provide the Soviets with a great victory.

Von Richthofen reported: "Of yesterday's 47 Ju 52s, 22 made sorties (into the Stalingrad pocket); of today's 30, 9 made sorties. We flew in 75 tons today, instead of the 300 tons ordered by the High Command, which is not possible with the few Ju 52s available."

More than 150,000 Axis soldiers, most of them German, were killed or wounded at Stalingrad and another 108,000 were captured.

This apparent madness, caused significant opposition to Hitler. Ulrich von Hassel held secret meetings with British and American officials, and hoped that a successful coup would translate into an honorable peace treaty. This, however, was not part of the plan, so the Jews had Roosevelt declare that only an unconditional surrender would be acceptable (January 1943). Thus, they saved their man from any coup, and he was free to continue his destruction of the German people.

The Jew Hitler tells the Soviets an attack will occur at Kursk. The Jew Hitler delays the attack for about three months, until the Soviets had built defensive lines, in places, eight deep. The Soviets concentrate 1,300,000 soldiers with 3,600 tanks, 20,000 artillery pieces, including 6,000 76mm anti-tank guns, and 2,800 aircraft in and around Kursk. An attack anywhere other than Kursk would be fatal for the Soviets, but the Soviets seem to know that the attack will come only at Kursk.

To incur the maximum possible number of German casualties, the Jew Hitler orders German troops to attack, as promised, at Kursk; to attack the most heavily defended lines ever constructed.

The Jew Hitler is amazed by the supermen of Army Group South, who, in the south, break through all the defensive lines and take on the reserve Soviet tank battalions. Some two weeks into the offensive, worried that the Army Group South might win the battle for the Germans, the Jew Hitler strips the elite SS Panzer Korps Leibstandarte of their tanks and sends them to Northern Italy, where they sit on their hands for some months before returning to the eastern front. The pretext of the Sicily invasion is used. To further ensure that Army Group South has to withdraw from the battle, Das Reich, Totenkopf, Grossdeutschland, and the operational reserve are split off, and sent elsewhere.

Before the Normandy invasion, Rommel stated the obvious; that the western tank divisions must be based close to the Atlantic coast. These tanks were necessary to stop the invasion force once it had penetrated the beach defenses. If the tank divisions were based too far from the coast, Allied air power would prevent them from reaching the critical areas, or delay them until it was too late.

Understanding this, the Jew Hitler based many of the tank divisions half way to Paris.

In an attempt to justify this stupidity, the Jew Hitler stated that one of his commanders, Gerd von Rundstedt, was of the opinion that the panzers should be formed into large units near Paris, where they would wait, allowing the Allies to extend into France, before cutting them off, and that Rundstedt's (crazy) opinion must not be ignored. Of course, Rundstedt was another covert Jew.

Not wanting to leave anything to chance, the Jew Hitler formed a strategic armor reserve, which could only be released for action by his authority. Early in the Normandy invasion, the Jew Hitler refused to commit any of the forces from the reserve, using the pretext that his staff were afraid to wake him. Later, he used the pretext that the real attack was not to be at Normandy, where the bombs were dropping and the troops landing, but would come in the Pas de Calais area.

Before the war, German scientists discovered the nerve gases Tabun (1936) and Sarin (1938). To manufacture Tabun, a large industrial complex was built at Dyhernfurth an der Oder, with more than 12,000 tons of Tabun eventually being produced. It was weaponized and stored at various locations in Germany and Poland, with a major storage area at Krappitz, some 100 kilometers from Auschwitz. Of course, the Nazis never used the nerve gas, Tabun, to mass-murder Jews at Auschwitz, simply because, the Nazis never mass-murdered any group at Auschwitz.

Even though the use of these thousands of tons of weaponized nerve gas would have won the war for Germany, the Jew Hitler refused to give the order to use it, and it remained in its storage areas until captured by the Allies.

The Germans had been the first to discover nuclear fission (which is the basis of uranium and plutonium atomic weapons) and before the war, were undisputed leaders in this area. By directing nuclear scientists to research nuclear reactors, rather than nuclear weapons, the Jews in the Nazi high-command were able to minimize the chance that Germany ever developed atomic weapons. However, since research into nuclear reactors naturally leads to nuclear weapons, funding in this area was limited to three million Deutschmarks per annum, and, in 1942, the number of scientists involved in nuclear research was cut from 70 to 44. As far as it is known, Germany had no scientists working on nuclear weapons, at any time during the war.

The Jew Hitler personally sabotaged German jet fighter development, by insisting that a bomber version of the fighter be developed and manufactured. When it tuned out that without bombs, the bomber version, was still a very impressive interceptor, Hitler demanded that they be flown by bomber pilots. Since the bomber pilots did not have the necessary fighter pilot training to perform and survive this type of mission, this proved a total disaster, as desired.

The British double agent, Eddie Chapman (Agent Zigzag), had the opportunity to kill Hitler in a suicide bombing at a Nazi rally. This he offered to do, however, the Jew Churchill (British prime minister) who had kept a personal interest in the Zigzag case, made sure that this opportunity to kill Hitler was rejected. Neither the British, nor the Americans, made any attempt on Hitler's life.

Hitler, Goering and Himmler, have close relatives who are Jews (e.g., Matthias Goering, the great-nephew of Hermann Goering, Katrin Himmler, the great-niece of Heinreich Himmler and Hitler's nephew's grandson) some of whom are currently living in Israel.

"We are not denying and are not afraid to confess that this war is our war and that it is waged for the liberation of Jewry... Stronger than all fronts together is our front, that of Jewry. We are not only giving this war our financial support on which the entire war production is based, we are not only providing our full propaganda power which is the moral energy that keeps this war going. The guarantee of victory is predominantly based on weakening the enemy forces, on destroying them in their own country, within the resistance. And we are the Trojan horses in the enemy's fortress. Thousands of Jews living in Europe constitute the principal factor in the destruction of our enemy. There, our front is a fact and the most valuable aid for victory (Weizmann is alluding to Hitler and other Jew Nazis)." Chaim Weizmann, President of the World Jewish Congress, Head of the Jewish Agency and later President of Israel.

I also came across this:

Jews, Nazis, Ukraine and Hitler.

So, how is it that the Jews, Oleksander Turchinov, Arseniy Yatsenyuk, Vitali Klitschko, etc, have teamed up with the Ukrainian Neo-Nazis to conduct a coup in the Ukraine. Why is the coup always called a Neo-Nazi coup but never a Jew coup (look it even rhymes). The Ukrainian coup was organized by Jews; they got the most important positions of power. So it was obviously a Jew coup. Then why the Neo-Nazis? Simply so the lying press could say "It was a Neo-Nazi coup." I think these Ukrainian Neo-Nazis are actually a "false flag" group of Jews.

Hitler was the same. Hitler was actually a Jew.

I have gathered yet more evidence from various web-sites and people, and it gets better & better. It is very interesting;

1) Hitler ordered the tanks to stop for 3 days near Dunkirk when only a short distance away. This allowed the entire British army and part of the French army to escape to Britain.

2) Hitler refused to take Gibraltar and turn the Mediterranean into a "German lake". There was nothing to stop the Germans from driving through Spain (their ally) and doing the job.

3) Hitler declared war on the United States.

4) Hitler refused to allow the tens of thousands of tons of weaponized nerve gas that the Germans had produced (at Dyhernfurth an der Oder) to be used. Over 500,000 artillery shells and about 100,000 bombs filled with nerve gas were found in their storage areas (mainly at Krappitz = Krapowice) at the end of the war.

5) Hitler refused to conquer Britain. After Dunkirk, Britain was totally defenseless.

6) The world's first jet fighter, the Heinkel He 178 was successfully flown on August 27, 1939. Heinkel demonstrated its capabilities to the Air Ministry on November 1, 1939, but the Jews Milch/Goering/Hitler showed no interest in it. An even more advanced jet fighter, the Heinkel He 280, was successfully demonstrated on April 5, 1941. In early 1942, it proved its excellent maneuverability and tremendous potential during a mock dogfight with a Focke-Wulf 190 (the best German fighter at the time) which the He 280 easily won. Consequently, the Jews Milch/Goering/Hitler were forced to promise a production run of 300 aircraft. However, the Jews were so successful in sabotaging the development that no Heinkel jet ever saw combat (however, Messerschmitt jets did). It is interesting, that as few as one hundred of these jets could have shot down every bomber sent (by the vicious British and Americans) to incinerate millions of German civilians. But Hitler didn't want this. As far as Hitler, and his Jewish buddies were concerned, the more dead Germans the better.

Note: Heinkel He 162 (Volksjager) jets were involved in combat during the closing weeks of the war.

7) Jewish financiers gave billions to finance Hitler's rise to power.

8) Only the Nazi's attempted to kill Hitler. The Americans, British and Soviets made no attempt to kill Hitler. It is known that the British refused to allow a number of feasible assassination plans to proceed.

9) An article from "The Jewish World" tells us that Hitler, Goering and Himmler, all have close relatives who are religious Jews. Namely, Hitler's nephew's grandson, Matthias Goering the great-nephew of Hermann Goering, and Katrin Himmler the great-niece of Heinreich Himmler. Hitler's nephew's grandson and Katrin Himmler live in Israel.

See: http://ou.org.s3.amazonaws.com/pdf/ja/5 ... /11_17.pdf

10) In 1932 the Jewish genealogist Karl Friedrich von Frank published Hitler's family tree. It was pointed out (June 16, 1932, in the newspaper Neue Zurcher Zeitung) that the name Salomon, which came up repeatedly in Hitler's maternal line, was unlikely to be Aryan. On July 14, 1933, the newspaper Osterreichisches Abendblatt published photographs of graves of various Hitlers from Jewish cemeteries and mentioned a cookbook written in Hebrew by Rosalie Hitler. Also, a number of Jewish families, surnamed Hitler, officially applied to have their names changed due to Hitler's (supposed) antisemitism. [From Hitler's Vienna by Brigitte Hamann.]

Learn from the past to prevent war in the future.

https://thesaker.is/request-for-comment ... nt-page-2/

Checking some points.

I have checked a few points mentioned above.

The Allied defeat at Dunkirk.

The Karl von Wiegand quote above can be found in "Witness to History" by Michael McLaughlin (born 1940, also known as Michael Walsh). I found a copy of the book here.

The statement by von Kleist was easily located. It appears to come from "The Other Side Of The Hill." (1948) by B. H. Liddell Hart. If not for Hitler, The British Expeditionary Force (B.E.F.) would have been completely surrounded by German forces while still deep in the interior of Flanders. They would have been completely cut off from the sea, their only means of escape. There was nothing to stop this encirclement, except Hitler. He was their last hope. So Hitler risked exposure as an enemy agent in order to save them.

Here are some quotes from the book:

Page 112: The escape of the British Army from France has often been called "the miracle of Dunkirk". For the German armoured forces had reached the Channel coast behind the back of the British Army while this was still deep in the interior of Flanders cut off from its own bases, and from the bulk of the French Army, it seemed likely also to be cut off from the sea. Those who got away have often wondered how they managed to do so. The answer is that Hitler's intervention saved them—when nothing else could have. A sudden order from him over the telephone stopped the armoured forces just as they were in sight of Dunkirk, and held them back until the retreating British had reached the port and slipped out of their clutches.

Page 112: But although the British Army thus escaped from the trap in France, it was in no state to defend England. It had left most of its weapons behind, and the stores at home were almost empty. In the following months Britain's small and scantily-armed forces faced the magnificently equipped army that had conquered France—with only a strip of water between them. Yet the invasion never came. At the time we believed that the repulse of the Luftwaffe in the "Battle over Britain" had saved her. That is only part of the explanation. The last part of it. The original cause, which goes deeper, is that Hitler did not want to conquer England. He took little interest in the invasion preparations, did nothing to spur them on, and cancelled at the first plausible excuse.

Page 139: On the 22nd, Boulogne was isolated by Guderian's advance, and next day Calais. That same day Reinhardt reached the Aire-St. Omer Canal, less than twenty miles from Dunkirk—the only escape port left to the British Expeditionary Force. The German armoured forces were much nearer to it than the bulk of the British Expeditionary Force. "At that moment," Rundstedt told me, "a sudden telephone call came from Colonel von Grieffenberg at O.K.H. [Oberkommando das Heeres; Army High Command], saying that Kleist's forces were to halt on the line of the canal. It was the Fuhrer's direct order—and contrary to General Halder's view. I questioned it in a message of protest, but received a curt telegram in reply, saying: 'The armoured divisions are to remain at medium artillery range from Dunkirk' (a distance of eight or nine miles). 'Permission is only granted for reconnaissance and protective movements'." Kleist said that when he got the order it seemed to make no sense to him. "I decided to ignore it, and to push on across the Canal. My armoured cars actually entered Hazebrouck, and cut across the British lines of retreat. I heard later that the British Commander-in-Chief, Lord Gort, had been in Hazebrouck at the time. But then came a more emphatic order that I was to withdraw behind the canal. My tanks were kept halted there for three days." Thoma, who was chief of the tank side of the General Staff, told me that he was right up forward with the leading tanks, near Bergues, where he could look into the town of Dunkirk itself. He sent back wireless messages direct to O.K.H., begging for permission to let the tanks push on. But his appeal had no effect. Referring to Hitler's attitude, he bitingly remarked: "You can never talk to a fool. Hitler spoilt the chance of victory."

Meanwhile the British forces streamed back towards Dunkirk, and cemented a defensive position to cover their re-embarkation. The German tank commanders had to sit and watch the British slipping away under their very noses. "After three days the ban was lifted," Kleist said, "and the advance was resumed—against stiffening opposition. It had just begun to make headway when it was interrupted by a fresh order from Hitler—that my forces were to be withdrawn, and sent southward for the attack on the line that the remainder of the French Army had improvised along the Somme. It was left to the infantry forces which had come down from Belgium to complete the occupation of Dunkirk—after the British had gone."

Liddell Hart released a second edition of the book a few years later. He added a fresh chapter on Guderian; "the subordinate commander who was insubordinately responsible for producing the staggering German victory in 1940." Here are a couple of quotes:

Page 53: In conference on the plan of the offensive they insisted that Guderian's spearhead of armoured divisions, after driving through the Ardennes, must wait on the Meuse for the arrival of the infantry mass. They held that a crossing of the river would not be possible until the ninth or tenth day from the start. In that case the French High Command would have had time, ample time, to reshuffle their dispositions, and bring their reserves to the spot to block the passage. But Guderian [contrary to the plan; i.e., he disregarded the order to wait for the infantry] forced a crossing on the day of his arrival on the Meuse—the fourth day from the start of the offensive. Then, despite the continued trepidation of the Higher Command, he drove on 160 miles through the back areas of the Allied armies, to cut their lines of supply. On the eleventh day of the offensive he reached the Channel coast, cutting off the left wing of the Allied armies. That lightning stroke virtually decided the issue of the campaign.... If Hitler had not ordered a halt, Guderian would have cut off the escape of the British Army (to and) from Dunkirk.

As a reward for his outstanding success, Guderian was ordered to stop the advance, and was actually relieved of his command by General von Kleist. However, some hours later, he was reinstated by General List, and given permission to carry on "strong reconnaissance," which Guderian interpreted as "carry on, much as before". In this way, Hitler's first halt order was circumvented.

Page 148: "Early on the 17th I was informed by Panzer Group Headquarters that the advance must be stopped, and that I personally was to await General von Kleist, for an interview on the airfield at 7 a.m. He arrived punctually and began straight away with grave reproaches to the effect that I had disregarded the plans of the High Command." Guderian maintained that he was fulfilling the spirit of the plan and emphasized the danger that a halt would mean losing the initiative, but got no satisfaction. "I asked to be relieved of my post. General von Kleist was slightly taken aback, but then nodded and told me to hand over command to the next senior.... When General List arrived,... he cancelled my removal from command, and explained that the halt order came from the top, so that it had to be enforced.... and gave me permission to carry on 'strong reconnaissance'".

General von Kleist had this to say;

"I must say that the English managed to escape that trap in Dunkirk, which I had so carefully laid, only with the personal help of Hitler. There was a channel from Arras to Dunkirk. I had already crossed this channel and my troops occupied the heights which jutted out over Flanders. Therefore, my panzer group had complete control of Dunkirk and the area in which the British were trapped. The fact of the matter is that the English would have been unable to get into Dunkirk because I had them covered. Then Hitler personally ordered that I should withdraw my troops from these heights." Why had Hitler ordered this? "Hitler thought it was too risky. It was nonsense; those orders of Hitler's in those days. We could have wiped out the British army completely or taken the whole army as captive if it weren't for the stupid order of Hitler. The proof of it is that three days later the English occupied the heights and I was obliged to attack them again to take them back. The masses of English troops, however, had already reached Dunkirk and were escaping in small boats. The sad part of it is that I could have captured the whole English army, or such a great part of it, at any rate, that an invasion of England would have been a simple affair." From "The Nuremberg Interviews" by Leon Goldensohn and Robert Gellately.

The Allied defeat at Kursk.

Some information in the article "Hitler was a Jew, working for the Jews." has been hard to find. And it is often difficult to sort out what actually happened (for example, what exactly did happen at Kurst). As to Kurst, the 2012 book "Decision in the Ukraine." by George Nipe, seems the best (of the few that I've skimmed).

A couple of years later: Recently, I was unable to obtain certain books that I needed for my regular work (which has nothing to do with war or Jews) and was at a loose end. So, I decided to read the book "Decision in the Ukraine," by George Nipe, which, as mentioned above, I had skimmed a couple of years back. It was not long before I encountered statements that I found very difficult to believe. Attempting to sort things out, I gathered a collection of books about Kursk, and set to work. Eventually, I was forced to the surprising conclusion that the battle of Prokhorovka (the greatest tank battle ever) was a complete work of fiction. Sorting things out, and writing up, took over two months. The result of this effort can be read below in the article:

Prokhorovka; the Greatest Tank Battle there never was.

The Production of Nerve Gas.

Tabun was the first deadly nerve gas known. It was discovered in January 1936 by the German researcher Gerhard Schrader.

Tabun was made on an industrial scale by Germany during World War II, based on a process developed by Gerhard Schrader. In a large production facility at Dyhernfurth an der Oder, at least 12,000 metric tons of this agent were manufactured between 1942 and 1945.

https://en.wikipedia.org/wiki/Tabun_(nerve_agent)

The nerve gas Sarin was discovered in 1938.... by Gerhard Schrader, Ambros, Ritter, and von der Linde.

In mid-1939, the formula for the Sarin was passed to the chemical warfare section of the German Army Weapons Office,... Pilot plants were built, and a high-production facility was under construction (but was not finished) by the end of World War II. Estimates for total sarin production by Nazi Germany range from 500 kg to 10 tons.

Sarin, tabun and soman were incorporated into artillery shells, [but not used] against Allied targets.

A person's clothing can release sarin for about 30 minutes after it has come in contact with sarin gas, which can lead to exposure of other people. [this is of interest because of the various false-flag sarin events in Syria]

https://en.wikipedia.org/wiki/Sarin

Here are some quotes from "Hitlers Secret Weapons 1933-1945: the essential facts and figures for Germany's secret weapons program" by David Porter. You can download the book from here, or here 57 MB.

During the 1930s, German researchers investigated the potential use of organo-phosphate compounds as commercial insecticides. While many were highly effective in agriculture, a few were found to be deadly nerve agents.

In 1939, trials to confirm the practicality of large scale Tabun manufacture were successfully carried out at an experimental plant at Munsterlager on Luneberg Heath. In January 1940, work began on the full-scale production facility, code named Hochwerk, at Dyernfurth-am-Oder (now Brzeg Dolny in Poland). The factory complex was run by an I.G. Farbenindustrie subsidiary, Anorgana GmbH, and was completely self-contained, synthesizing all intermediates as well as Tabun itself. The facility had an underground plant for filling munitions, which were then stored at Krappitz (now Krapowice) in Upper Silesia.

Although 500,000 artillery shells and 100,000 bombs filled with Tabun had been stockpiled by the end of the war, none were ever used...

Page 166 shows a photo of Tabun-filled nerve gas artillery shells in a storage area.

Sabotage of Aircraft Production.

I checked "Jane's Fighting Aircraft of World War II." and it says "The Heinkel He 178, was test-flown on August 27, 1939, was the first jet propelled aircraft to fly. It was a shoulder-wing monoplane and was fitted with a large-diameter He S-3 turbojet unit which developed a thrust of about 1,000 lbs."

"The Heinkel He 280 was a single-seat jet-propelled fighter which was originally under development in the Summer of 1939. It had a typical Heinkel fighter fuselage.... and was eventually abandoned in late 1944."

It is often claimed that the He 178 was the first jet propelled aircraft to fly. This is (deliberately) incorrect. It was the first turbojet to fly, however, it was not the first jet propelled aircraft to fly. That honor would go to one of the solid-fueled jets built by various German nationals in the late twenties, and thirties. The first liquid-fueled jet was the He 176 which "Jane's Fighting Aircraft of World War II," doesn't even bother to mention.

A useful definition of a jet is; an object that continuously moves forward by ejecting a jet of material (solid, liquid or gas) backward.

From "Aircraft of the Luftwaffe, 1935-1945: An Illustrated Guide" by Jean-Denis Lepage, we have:

Heinkel He 176

The He 176 was the first aircraft in history to fly using only liquid-fueled rocket power. Design work was begun in late 1936, with detailed engineering drawings being completed around July 1937. Construction of the prototype began at the same time... The first official flight was on June 20, 1939 flown by Flugkapitän Erich Warsitz. On the next day, the He 176 was demonstrated in front of some of the Reichsluftfahrtministerium leaders (including Ernst Udet and Erhard Milch)... On July 3, 1939, a demonstration was arranged at Roggentin for Adolf Hitler.

Heinkel He 178

A private venture of the Ernst Heinkel AG Company, the He 178 claims the fame of being the first jet-powered aircraft ever. The small experimental fighter He 178, designed by engineer Hans-Joachim Pabst von Ohain, was successfully tested in August 1939. The He 178 was a shoulder-wing monoplane with the cockpit well forward of the wing leading edge. It had a He S 3 B turbojet engine, a retractable landing gear, a speed of 700 km/h (435 mph), a wingspan of 7.20 m (23 ft 3 in), and a length of 7.48 m (24 ft 6 in). Udet and Milch attended a test flight at the Marienehe base on November 1, 1939, but—in spite of its tremendous potential—the futuristic He 178 did not generate much interest from the RLM (Reichsluftfahrtministerium = Ministry of Aviation = Air ministry). Just like the later Heinkel He 280, a remarkable twin-jet-engine combat fighter from 1940, the He 178 appeared at a time when the RLM showed no interest in [the] new development....

Goering and Milch were number one and two at the Air ministry. If Milch, Goering (and Hitler) were Jews as claimed then it is no surprise that Air ministry found no interest in these remarkable jet-aircraft.

Louis Snyder, in his Encyclopedia of the Third Reich, states that Milch's mother was Jewish.

There was a complicating factor: Milch's mother was Jewish, ordinarily an impossible situation for an official of the Nazi regime. Goering solved the problem by having Milch's mother sign a legal affidavit stating that Erhard Milch was a bastard son of his father and not a child of her marriage. Milch did not object to this process of Aryanization. This was a standard procedure for Goering, who never took anti-Semitism as seriously as did the Fuehrer. Goering habitually drew non-Aryan officers (Jews) to the Luftwaffe.... [which helps explain why the Luftwaffe failed so spectacularly].

The He 178 was not only an experimental aircraft, but was also designed to be a fighter aircraft. (Die He 178 war nicht nur ein Versuchsflugzeug, sondern auch konstruktiv für die Ableitung eines Jagdflugzeuges ausgelegt.) From the book "Heinkel: Chronik Und Typenblatter Der Firma Heinkel", by Aviatic Verlag.

Heinkel He 280

The single-seat, two-jet-engine fighter Heinkel He 280 was a remarkable achievement designed by engineer Max Müller from the Jumo Company. The second Heinkel jet aircraft had a span of 12 m (39 ft 5 in), a length of 10.20 m (33 ft 5.5 in), a height of 3.19 m (10 ft 6 in) and an empty weight of 3,350 kg (7,386 lbs). It had twin fins and retractable tricycle landing gear, and was powered by two Junkers Jumo 004A turbojets mounted under the wings which gave a maximum speed of 817 km/h (508 mph) and a range of 615 km (382 miles). Intended armament was three 20-mm MG 151 cannons, and a bomb load of 500 kg (1,102 lbs) for the envisioned He 280B fighter/bomber version. The prototype He 280 V1 made its first flight in April 1941, and proved its excellent maneuverability and tremendous potential during a mock dogfight with a Focke-Wulf 190 in early 1942 which the He 280 easily won. Yet this attractive and advanced craft appeared at a time when the German leadership showed no interest in jet aircraft....

The book, "Hitler's Secret Weapons 1933-1945," has this to say about the He 280 (pages 103-104):

In late 1939, Heinkel began the He 280 project on its own initiative after the world's first practical jet, the He 178, had failed to attract official support. The first prototype (of the He 280) was completed in the summer of 1940, but delays in the development of its HeS 8 engine confined it to flight trials in glider configuration. It was not until 30 March 1941 that the second prototype made its first powered flight, but failed to impress General Ernst Udet, head of the Air Ministry's development wing. Heinkel continued to develop the type despite the lack of official backing and arranged for trials that pitted it against the Focke-Wulf Fw 190, the best contemporary German fighter. In one trial, the He 280 completed four laps of an oval course before the Fw 190 could complete three, while in a later mock combat, it convincingly out-fought the Focke-Wulf. This was sufficient to win an order for 20 pre-production aircraft, to be followed by an initial production run of 300 machines, which were intended to be armed with three 20mm (0.79in) MG 151 cannon. Chronic engine problems (mainly due to sabotage by the many covert Jews working in the aircraft factories) continued to plague the project and a range of alternatives were tried, including the Argus As 014 pulse jet of the V1, which quickly proved to be impractical for use in manned aircraft. This search for viable alternatives delayed the programme so badly that it was cancelled in March 1943 as its development was overtaken by the Me 262.

Further information on the Heinkel He 176, He 178, and He 280 from "Heinkel: Chronik Und Typenblatter Der Firma Heinkel" can be found here. An English translation of the text is here.

Nuclear Weapons.

Concerning nuclear weapons David Porter's book states:

The generally accepted history of German nuclear research indicates that from 1942 onwards, little practical progress was made towards a viable weapon - Speer attempted to get Professor Werner Heisenberg, one of the principal experts in the field, to give him some straight answers about the feasibility of producing an atomic weapon in a reasonable time-scale. Heisenberg supposedly told him that even with generous funding, it would take at least three or four years, at which point Speer recalled that, 'we scuttled the project to develop an atomic bomb'. Thereafter, research efforts were largely concentrated on building practical nuclear reactors. This seems incredible unless Speer was yet another Jew.

The accepted history paints a picture of sustained German incompetence [or sustained Jewish sabotage] in the field of nuclear research that is in marked contrast to their achievements in other areas of military technology. This account begins to look increasingly improbable as closer examination of the period throws up a number of inconsistencies.

It is certainly possible [but very unlikely] that the fragmentation of the German nuclear research programme in 1942 was a security measure.

Carl Friedrich von Weizsacker, one of the members of the second Uranverein, filed a draft patent application indicating that the production of plutonium and its military potential were well understood. The application includes the following summary: The production of element 94 [plutonium] in practically useful amounts is best done with the 'uranium machine' [nuclear reactor]. It is especially advantageous - and this is the main benefit of the invention - that the element 94 thereby produced can easily be separated from uranium chemically. The document also specifically goes on to note the use of plutonium to produce an exceptionally powerful bomb: "With regard to energy per unit weight, this explosive would be around 10 million times greater than any other [existing explosive] and comparable only to pure uranium 235." [Was this patent then registered in London and Washington?]

The potential use of nuclear fission to produce a bomb of unprecedented power was investigated by German scientists from 1939 onwards, but they were crucially just behind the US and UK in developing an operational weapon. [The book presents no evidence for the claim that Germany was just behind the US in nuclear weapon development.]

Operation Felix.

Hitler refused to take Gibraltar and turn the Mediterranean into a "German lake". There was nothing to stop the Germans from driving through Spain (their ally) and doing the job. Alternatively, they could have organised an attack from German (previously French) Morocco, only a few miles away.

Spain was ostensibly neutral, but Franco and his crowd owed the Nazi's for winning support in the Spanish civil war. It was extremely unlikely that Franco would have opposed the Nazis sending an army through Spain to take Gibraltar. This should have been as easy as the Japanese taking of Singapore. Without Hitler, I doubt the Germans would have had much trouble taking Gibraltar.

A plan, called Operation Felix, and dated November 12, 1940, stated: 1. Relations with France: The aim of my policy toward France is to cooperate with this country in the most effective way for the future prosecution of the war against England. For the time being France will have the role of a "non-belligerent power" which will have to tolerate German military measures on her territory,... 2. Spain and Portugal: Political measures to induce the prompt entry of Spain into the war have been initiated. The aim of German intervention in the Iberian Peninsula (code name Felix) will be to drive the English out of the Western Mediterranean. For this purpose: a) Gibraltar should be taken and the Straits closed; The English should be prevented from gaining a foothold at another point of the Iberian Peninsula or of the Atlantic islands. From "Hitler's Plan To Capture Gibraltar" (1985) by Joe Garcia.

Operation Felix may have been a fake plan concocted after the war. But, if not, then (a faction among) the Germans had the intention to take Gibraltar. That Hitler was able to prevent this happening, without giving himself away, shows the truly amazing con-man, he was.

Hitler's Vienna.

The claims made from the book "Hitler's Vienna" seem to be correct. From page 45 & 46 we have:

Hitler retained (the Viennese genealogist Karl Friedrich von) Frank's services on February 29. The genealogist mailed his report as early as April 8, 1932, on the same day on which the headlines of late newspaper editions announced in huge block letters: "Hitler's Name Is Schucklgruber." In the article the young reporter Hans Bekessi, who later went by the name of Hans Habe, revealed the heretofore unknown history of Hitler's father's late change of name—a revelation that had a spectacular impact. Tens of thousands of copies of the newspaper were hauled into Germany to affect the election campaign....

Yet in the summer of 1932 there was an even far greater uproar in the press. First, on June 16, the Neue Zurcher Zeitung published a letter to the editor regarding the topic of "Hitler's Ancestors": the sender questioned Frank's opinion that "with the exception of the name Wallj [the family chart contained] only German names," and offered that "the family name Salomon, which comes up repeatedly," surely couldn't be "accepted without qualms as a German name.... At least, Adolf Hitler and his followers are not in the habit of simply accepting that name as a German name." In the family tree that Frank published, there appears as a great-great-great-grandmother, as number forty-five, a Catholic Katharina Salomon from Nieder-Plottbach, parish of Dollersheim, daughter of the Catholic farmer Johann Salomon in Nieder-Plottbach. It was the appearance of this Jewish-sounding name that started speculations about Hitler's alleged Jewish background.

In the meantime Bekessi had become an editor for the Osterreichisches Abendblatt and published new revelations starting on July 12; for example, on July 14, 1933: "Awesome Traces of the Hitler Jews in Vienna," with photographs from Hitler graves in the Jewish section of Vienna's Central Cemetery and a cookbook by one Rosalie Hitler, written in Hebrew.

One should mention that Frank claimed that his original genealogy was incorrect and later in the following year, 1933, presented an extended family tree of Hitler with the name Salomon removed. However, this was generally viewed as a cover-up.

The Jewish World.

The article from "The Jewish World" does indeed claim that Hitler, Goering, and Himmler, all have close relatives who are closely associated with Jews. Some quotes:

"Hitler's nephew's grandson—right here in Israel—and a Jew!"

"Recent newspaper articles published in both Europe and Canada have detailed the extraordinary metamorphoses of people like Matthias Goering, great-nephew of the notorious Luftwaffe Chief Hermann Goering, who keeps kosher, celebrates Shabbat and wears a yarmulka; Katrin Himmler, great-niece of SS Commander Heinreich Himmler, who married an Israeli and Oskar Eder, a former member of the Luftwaffe who changed his name to Asher,..."

Did Jewish financiers give billions to finance Hitler's rise to power? I don't know, but apparently the book "Wall Street and the rise of Hitler" by Antony C. Sutton deals with this topic.

In my web-wanderings I also found this:

Hitler was a British Agent.

"Hitler was a British Agent", by Greg Hallett. I haven't been able to find a copy of this book, but it sounds interesting. I have been told that Hallett is a Jew and wrote "Hitler was a British Agent." to prevent people writing a book called "Hitler was a Jewish Agent." I guess there is some logic to that. I know next to nothing about Hallett, let alone about his motives for writing the book.

Hitler's Genealogy.

An interesting article concerning Hitler's genealogy is:

http://mileswmathis.com/hiller.pdf

This is definitely worth a look. Miles Mathis looks at the genealogies of some of the important Nazi's (including Hitler) and pronounces them Jews. He finds that many are related to each other (and to US President Donald Trump)! I have no idea how correct his findings are. Here is a quote:

"Olga Obrist marries an Edward Hedinger. I suspect these are all variants of the same name, but even if they aren't, we have just linked the Henningers and Hettingers through the Obersts. They are from the same town in the same years, and are linked to all these obviously Jewish families. To salt that in, we also get the Görings and Brauns and Hoffmanns. Also the Schicks. Hitler's grandmother was a Schicklgruber, remember? So not only have we just linked (US President Donald) Trump and Heinz to Himmler, we have linked Himmler to Göring, Braun, and Hitler. It looks like they were all cousins."

DNA tests show Hitler had Jewish roots.

Adolf Hitler is likely to have had Jewish (or Berber) roots, DNA tests have shown.

By Heidi Blake 6:25AM BST 24 Aug 2010

Saliva samples taken from 39 relatives of the Nazi leader show he may have had biological links to Jews.

For the complete story from the Daily Telegraph (British newspaper), click here.

And to top it off, it appears that;

Hitler's wife was a Jew.

Eva Braun, Adolf Hitler's long-term lover who married the Nazi leader hours before their joint suicide in his Berlin bunker, may have had Jewish ancestry, ground-breaking DNA testing has found. DNA analysis of hair samples from a hairbrush claimed to belong to Braun suggests that the fascist dictator may have unwittingly married a woman of semitic descent, in one of his final acts as the Third Reich crumbled. The revelation appears in a Channel 4 documentary, Dead Famous DNA, broadcast next week, in which leading scientists attempt to extract DNA from relics and analyse their genome to solve mysteries associated with them. Forensic scientists sequenced the hypervariable region of the mitochondrial DNA from a sample of hairs extracted from a monogrammed hairbrush found at the end of the Second World War in Braun's apartment at Hitler's Alpine residence, the Berghof in Bavaria, by an American army intelligence officer. They found a specific sequence within the mitochondrial DNA, a small genome within the mitochondria of the cell that is passed down the maternal line from mother to daughter unchanged over the generations, belonging to haplogroup N1b1, which is associated with Ashkenazi Jews. A haplogroup is a particular sequence of mitochondrial DNA which is passed down the maternal line and according to traditional Jewish law, Judaism is passed down through matrilineal descent....

For the complete story from the Independent (British newspaper), click here.

Like I said there is a heap of stuff to look at. However, I've spent much more time investigating this than I planned and I find the whole subject rather disturbing, quite scary, in fact. So, I'm headed back to my usual work.

And here is something about the first world war:

Proof that WW1 was fought to steal Palestine/Israel for the Jews.

The First World War; 100 years of lies.

So, why was the first world war planned and executed?

To steal Palestine/Israel for the Jews!

The plan was already well known in 1853.

The following is a quote from George Faber's 1853 book on the downfall of the Turkish power and the return of the ten tribes (available here).

"The subversion of the Turkish Power will evidently occasion, as all seem to anticipate, a fearful general war. This war will, I believe, be the last under the present order of things. It will commence, indeed, in Europe: but,... it will pass into Palestine.... and, in the course of its evolutions, Israel will be restored."

George Faber and his fellow conspirators, the Jews, successfully bought the plan to fruition:

"The subversion of the Turkish Power [i.e., the Ottoman Empire] will evidently occasion, as all seem to anticipate, a fearful general war [i.e., the first world war]. This war will, I believe, be the last under the present order of things [ushering a new world order]. It will commence, indeed, in Europe [with the assassination of Archduke Franz Ferdinand in 1914]: but,... it will pass into Palestine [western troops entered Palestine early in 1917].... and, in the course of its evolutions [the second world war beginning 1939], Israel will be restored [Palestine/Israel was successfully stolen from its rightful inhabitants in 1948]."

Some have complained that George Faber should not be included among the conspirators. They claim that he was just being used by the Jews to attain their ends. To back up their claim they state that Faber foresaw the return of all twelve tribes of Israel, which never happened, whereas the Jews only wanted the return of the Jews, which did happen. Once the Jews had obtained their goal, no more was heard about the return of the other tribes, it just wasn't a concern. This indicates that Faber's notions were of little importance, and that he was being used by the conspirators, rather than that he was among the conspirators.

Were Roosevelt, Churchill, Stalin, and Hitler, really Jews?

Some have questioned whether it is possible that Roosevelt (USA), Churchill (England), Stalin (Russia), and Hitler (Germany) could have all been Jews; but it is like that today, as you can see from the following pages:

https://web.archive.org/web/20131030133 ... eaders.htm
https://web.archive.org/web/20131030133 ... index.html

These two pages have photos of a large number of political leaders that appear to be Jewish; these include Reagan, Clinton, Bush, Obama, Trump, and Biden (USA), Blair, Brown (England), Chretein, Harper (Canada), Chirac, Sarkozy (France), Merkel (Germany), Kaczynski (Poland), and Putin (Russia).

Here is a montage of a few of the photos:

Image

Other popular topics are:

A few books on Religion and Mythology (Free Downloads).
A large collection of photos of Jewish political leaders wearing skullcaps, e.g., Nelson Mandela, Tony Blair, Gordon Brown, etc.
There are no ancient Jewish cities in Israel, but there are lots of ancient Greek cities.
WOW; Presidents Reagan, Clinton, Bush, Obama, Trump, and Biden are Jews.
Is it too late to save Florida from Drowning? The Conspiracy to hide Global Warming.
The free Operating System Linux running Microsoft Operating Systems on Virtual Computers (a DIY guide).
Proof that the name ADAM is of Greek origin.
preearth
 
Posts: 51
Joined: Tue Jun 08, 2010 5:52 am

The world's greatest tank battle. It never happened!

Postby preearth » Sun Oct 20, 2019 3:16 am

Prokhorovka; the Greatest Tank Battle there never was.

The original myth: On July 12, 1943, near the town of Prokhorovka, 850 Soviet and 700-800 German tanks rolled towards each other like two steel avalanches. In the encounter, 400 German tanks are said to have been destroyed, and the units of the SS-Panzerkorps crushed. This was a great victory for the Soviets. The turning point of world war two.

When the combat records of the SS-Panzerkorps were investigated it was found that, on July 12, 1943, SS-Panzerkorp Leibstandarte, and SS-Panzerkorp Reich had at most 117 battle tanks, 37 assault guns, and 32 tank destroyers which could be deployed against the 5th Guards Tank Army in the "greatest tank battle of all time". Clearly, the myth was in need of revision. [1]

The revised myth: On July 12, 1943, near the town of Prokhorovka, 850 Soviet tanks and 186 German fighting vehicles collided in the killing fields west of the town. In the encounter, as many as 650 Soviet tanks are said to have been destroyed, and the units of the 5th Guards Tank Army crushed. This was a great tactical loss, but somehow, a great strategic victory, for the Soviets. The turning point of world war two.

Neither version of the myth is anything like the truth.

The truth is that the famed "greatest tank battle of all time" never happened at all.

The most interesting aspect of these myths is why they have been told.

In both versions of the myth, the 5th Guards Tank Army arrives at the Prokhorovka battlefield from its bases far to the east, where it had formed part of a strategic reserve called the Steppe Front, and whether or not this army wins the battle against the SS-Panzerkorps, its last minute appearance changes the course of the entire second world war.

To get from their bases to the battlefield the 5th Guards Tank Army had to march (i.e., drive its 850 tanks, tow its artillery, and flak guns, truck its ammunition, and transport its 40,000 men, together with their supplies) somewhere between 300 and 400 kilometers over unimproved dirt roads, and they had to do this within three days. Each of the three armored columns involved in this march was about 24 kilometers (15 miles) long. [2]

For many reasons, both myths are impossible to believe.

The T-34s were notoriously unreliable. How did so many make the distance?

The main Russian battle tank, the T-34, had proved so unreliable that in April 1943 a policy was introduced whereby every tank was given a 30 kilometer test at the factory, followed by a 50 kilometer test by military inspectors, before the tank would be accepted by the army. In addition, one tank from every hundred was subjected to a 300-kilometer test run. The results of the 300-kilometer test runs were appalling, with 90% of the tanks breaking down before reaching 300 kilometers. Remedial action was taken so that by December 1943 only 16% of the T-34s tested broke down before reaching 300-kilometers. [3]

Soviet factory documents record the percentage of T-34 tanks that broke down during the 300 kilometer test (i.e., broke down before reaching 300 kilometers) for each month from April 1943. They are: April 90%, May 77%, June 92%, July 71%, August 57%, September 54%, October 22%, November 43%, and December 16%. [4]

Obviously the T-34s that participated in the Kursk battles were built before July 1943. Therefore they were among those found to be extremely unreliable. From these factory statistics one would expect significantly less than a quarter of the tanks to make the distance.

Most authors make no mention of the break-downs on route. Those that do, mention very different figures:

"Rotmistrov (the commander of the 5th Guards Tank Army) now had a gross total of 931 tanks: 581 T34s, 314 T70s and a few SUs. There would be 707 tanks ready to launch in the morning. 558 tanks would be in first echelon,... There were also a little over 100 tanks that broke down in transit that would be made available in the next two weeks." [5]

"Rotmistrov's 5th Guards Tank Army was just completing an impressive 400km road march on its own tracks and was assembling 15km north of Prokhorovka. Although 227 of Rotmistrov's 721 armoured vehicles broke down en route, Soviet repair units were able to restore half within the next 36 hours." [6]

"By dint of a remarkable effort that had seen his Guards Tank Army traverse many hundreds of kilometres in just a few days, the bulk of Rotmistrov's units arrived within its assembly areas lying just to the north of the Psel in the closing hours of 9 July. Very few of the robust T-34s had fallen out with mechanical failure on this forced route march, and the extremely efficient repair teams quickly fixed those that had." [7]

The break-down figures given completely contradict the factory statistics (and contradict each other).

It appears that some authors just made up break-down statistics to solve the problem of there being no records of break-downs on route. Others will now quote these made up statistics, and they will eventually become "history".

How did the armored columns cross the Oskol river?

To answer this question we will try to establish the route the 5th Guards Tank Army (supposedly) took. The 5th Guards Tank Army consisted of the 18th Tank Corps, the 29th Tank Corps and the 5th Guards Mechanized Corps. We are told that:

"The 5th Guards Tank Army concentrated with the 29th Tank Corps in the forests west of Ostrogozhsk, the 5th Guards Zimovniki Mechanized Corps in the Kamenka region, and the 3d Guards Stalingrad Mechanized Corps in the Kuzmenkov (Pisarevka) region.... the 18th Tank Corps (was) located in the Rossosh region." [8]

So, the 29th Tank Corps started its march near Ostrogozhsk, the 5th Guards Mechanized Corps started near Kamenka, and the 18th Tank Corps started near Rossosh. Note that this Kamenka is about 40 kms from Ostrogozhsk and not the Kamenka (Kamyanka) marked on Glantz and Orenstein's map (see below).

Apart from the starting points, and destinations, we are told almost nothing about the route, only that the 5th Guards Tank Army passed through Staryi Oskol (Stary Oskol). [9] That the route transited Staryi Oskol seemed rather odd.

We also have this: "By the beginning of combat operations, our forces had one dual-rail lateral rail line, Tula-Elets-Kastornoe-Staryi Oskol-Valuiki, with a capacity of 40 to 45 pairs of trains per day. Several rail lines branched out from the lateral line to the front, including the Kastornoe-Kursk-L'gov, with a capacity of no more than 12 to 18 pairs. A dual-rail line ran from Liski Station, across Ostrogozhsk and Alekseevka to Valuiki and Kupiansk, which, because of major destruction, had a limited capacity. The following dirt roads had great significance for the Voronezh and the Steppe Fronts: Staryi Oskol-Tim-Kursk; Staryi Oskol-Korocha-Volchansk; Novyi Oskol-Belgorod; and Novyi Oskol-Volchansk. The Efremov-Elets-Voronezh; Kursk-Fatezh; Kursk-L'gov; and Kursk-Ternovka surfaced roads (gravel roads) were also significant. The main cargo flow for the forces traveled along these roads." [10]

This passage names the main railroads and roads used by the forces of the Voronezh and Steppe Fronts. What is interesting, is that not one of the roads mentioned goes anywhere near Ostrogozhsk, Kamenka or Rossosh (the bases of the units of the 5th Guards Tank Army). However, there is a dual rail line running from Liski to Valuiki which passes through Ostrogozhsk, and we find that both Kamenka and Rossosh are connected to Liski (and thus Ostrogozhsk) by rail.

So, it appears that the fable originally posited transportation of the 5th Guards Tank Army by rail.

Transportation by rail dovetails nicely with the fact that the route passes through Staryi Oskol, as there is a north-south rail line from Valuiki to Staryi Oskol, from which a branch line connects to the Kursk-Belgorod rail line which runs south to Prokhorovka (see the maps below). This branch line provides the only rail bridge over the Oskol river (north of Kupiansk in Ukraine). Even today, this bridge is the only Russian rail bridge over the Oskol river.

By road, the distance from Prokhorovka to Ostrogozhsk is only 200 kms (to Kamenka 240 kms; to Rossosh 260 kms). So, why do most authors report a march of nearly double this length? One guesses that this is a holdover from when the fable involved transportation by rail, for the distance from Ostrogozhsk to Staryi Oskol (via Valuiki) by rail is 280 kms. Add to this a 120 km trip from Staryi Oskol to about 20 km north of Prokhorovka, and we have 400 kms, double the road length.

The march is said to have occurred in two stages. The first march, from their bases to south and west of Staryi Oskol, occurred on July 7. The army rested on July 8. The second march, has the 5th Guards Tank Army deployed to a region about 20 kms north of Prokhorovka by the end of July 9, and then assemble east of Prokhorovka on July 11. Note that the march route approaches Prokhorovka from the north, just like the rail route. This route makes sense if one is using rail as there is only one rail route. However, it makes no sense by road. By road, the distance from (south and west of) Staryi Oskol to (east of) Prokhorovka via the northern road route is roughly 160 + 20 = 180 kms, while the eastern road route is about 100 - 20 = 80 kms. Why march an extra 100 kms?

Reflecting on this, it appears that the creators of history took an existing plan for the movement of troops by rail, that had probably been executed some time earlier (at a time when the Oskol river rail bridge at Staryi Oskol was operational), and simply changed the names, and sizes of the units, and the dates. Of course, during the early part of the Kursk offensive the rail bridge at Staryi Oskol would have been mostly at the bottom of the river, so the creators of the fable also changed, transportation by rail, to transportation by road, that is, to a march. Without this change, the broken rail bridge at Staryi Oskol would immediately invite the question; How did they cross the river? In this way, the creators of history assembled a great force at Prokhorovka, an imaginary force that fought an imaginary battle that changed the course of world war two.

Once the story had morphed into a march, the crossing of the Oskol river could be moved south from Staryi Oskol to near Krasnyy Ostrov, significantly reducing the length of the march. Some authors implicitly claim two crossings, one near Krasnyy Ostrov and the other near Novyi Oskol (Novy Oskol). These authors do not say how the river was crossed. Neither town had a rail bridge (and still don't) so the 5th Guards Tank Army had to be ferried across, or the river had to be bridged. This could not be done that quickly, even if the Luftwaffe decided to close its eyes and go to sleep.

Once the Oskol river crossing is moved south to Krasnyy Ostrov (and/or Novyi Oskol), it is impossible to believe that the northern route to Prokhorovka was taken; thus it has to be replaced by an approach from the east. However, the founding documents of the fable unequivocally state that the 5th Guards Tank Army approached from the north. But then, the founding documents also say that the 5th Guards Tank Army was not being sent to Prokhorovka at all, but to defend the Belgorod-Oboyan-Kursk road (the Oboyan axis or corridor). So, clearly it is possible for the fable to drift a long way from the original, and even to contradict it. The Soviet General Staff Study states:

"Considering the intensity of the situation on the Oboian (Oboyan) axis, on 8 July the Stavka of the Supreme High Command ordered the 5th Guards Tank Army to concentrate in the Bobryshevo, Sredniaia Ol'shanka, and Marino region by the end of 9 July, having advanced its forward detachments forward to the Psel River in the Oboian and Veselyi sector. By 2300 hours on 9 July the army had concentrated in the designated region, and its forward detachments reached the Psel River on the next morning. Naturally, the front commander directed his main attention toward the strengthening of the Oboian axis to a maximum." [11]

So the 5th Guards Tank Army was to gather in the Bobryshevo, Sredniaia Ol'shanka, and Marino region, north of Prokhorovka, and then deploy west to the Oboyan-Veselyi line, i.e., deploy along the Psel River (which in this area flows north-west and is parallel to the Oboyan-Veselyi line) in order to strengthen the defense along the Belgorod-Oboyan-Kursk road, i.e., to strengthen the Oboyan axis. Of course, this contradicts other versions of the fable which has the 5th Guards Tank Army rushing to strengthen the Prokhorovka axis.

Incidently, the deployment toward the Psel river north and west of Veselyi, on July 9, is completely at odds with SS-Panzerkorp Totenkopf capturing the south bank of the Psel river, some three or four kilometers south and east of Veselyi, on the same day.

In what follows, note that the real 5th Guards Army is not the imaginary 5th Guards Tank Army.

Summing up: Sometime before the Kursk offensive, the 5th Guards Army was deployed to the Bobryshevo, Sredniaia Ol'shanka, and Marino region some 20 kms north of Prokhorovka, where it formed part of a strategic reserve. This reserve was eventually fed piecemeal into the battle in aid of the badly battered First Tank Army and essentially destroyed. Since the Sixth Guards Army had been knocked out, the First Tank Army badly battered, and the hurriedly brought up reserves frittered away piecemeal, there was no force left to smash the Germans and explain their, otherwise inexplicable, withdrawal from the battle. [12] So, the creators of history provided the imaginary 5th Guards Tank Army. It would be loosely modelled on the 5th Guards Army. Some of the units of the 5th Guards Army were from the Ostrogozhsk-Kamenka-Rossosh region, so the 5th Guards Tank Army would be from the Ostrogozhsk-Kamenka-Rossosh region. They had been transported to the area by rail, however this was no longer possible, so the hapless 5th Guards Tank Army was scripted to march the rail route. This meant their route was much, much longer than necessary, and approached Prokhorovka from the north. To provide a shorter more believable route, some authors have since moved the route south, crossing the Oskol river around Krasnyy Ostrov, and approaching Prokhorovka from the east.

The evolution of the fable from a northern approach to an eastern approach can be seen in the following quotes:

"By day's end, Rotmistrov's huge armoured phalanx (the 5th Guards Tank Army) was 60 miles from its designated assembly area in the vicinity of the small agricultural town of Prokhorovka. The Tank Army rolled southward (i.e., from the north) across a front some twenty miles wide." [13]

"The forward units of the 5th Guards Tank Army began arriving behind the Psel River-Prokhorovka line after dark. Trailing units were still in the Bobryshevo-Marino area (north of Prokhorovka), up to 50 miles behind." [14] (There is an error here. 50 miles is 80 kms, however, the Bobryshevo-Marino line is only about 25 kms north of Prokhorovka.)

"By 10 July, as the main body of 5th Guards Tank Army approached Prochorovka from the east, some elements of the 2nd Tank Corps and 2nd Guards Tank Corps were already involved in fighting against Kempf's III. Panzerkorps." [15]

Although the two versions are contradictory, some authors manage to give both; for example, the text of Glantz and Orenstein states that the 5th Guards Tank Army approached Prokhorovka from the north, but their map (see below) shows the 5th Guards Tank Army approaching Prokhorovka from the east. [18]

Such contradictory features are to be expected when fiction is grafted over actual events.

The confusion generated by all this can be seen in the following quotes, which have the 5th Guards Tank Army assembling in two different places by the end of July 9.

"the 5th Guards Tank Army was ordered to concentrate in the Bobryshevo, Sredniaia Ol'shanka, and Marino region (north of Prokhorovka) by the end of 9 July." [16]

"Konev alerted me that by the end of 9 July, Lieutenant General of Tank Forces Rotmistrov's 5th Guards Tank Army would be assembling east of Prokhorovka." [17]

The problem of crossing the Oskol river is almost universally ignored. It just happened, like magic. The only author to broach the subject (that I am aware of) is Mark Healy. The paragraph mentioning this is worth quoting in full:

"By late afternoon, Rotmistrov's forces had crossed the pontoon bridge spanning the River Oskol and begun the final stage in their drive towards Prokhorovka. Advancing across a wide front, the vast dust clouds raised by this enormous formation had broadcast its presence to enemy aircraft many miles away. Though heavily screened by fighter detachments, these had not been enough to deter snooping German reconnaissance aircraft, not that the Soviets had ever believed it possible to disguise the advance of such a large force when travelling by night and day. Of greater significance to Rotmistrov was the surprising lack of any follow-up by the Luftwaffe to interdict the Tank Army en route to the battlefield, which meant that other than those machines that were bound to fall out owing to breakdowns, his formation would arrive near Prokhorovka at full strength. That the Luftwaffe failed even to attempt to attack 5th Guards Tank Army before it reached the vicinity of Prokhorovka shows how limited its assets were by this time. It was unable to release so much as one bomber or Stuka staffel from its immediate task of battlefield support of the ground forces in the salient, to stem this approaching avalanche of Soviet armour, a tactic that would have been automatic just two years before." [19]

This shows how ridiculous the fable has become. Yet people still buy into it.

In truth, if a bridge (of any type) had sprung up overnight, the Germans would have certainly destroyed it. Keeping hundreds of tanks and artillery guns on the other side of the Oskol river was a no-brainer. Don't forget that the Germans had air-superiority over the salient for the whole period of the Kursk offensive, and Stary Oskol, Novyi Oskol, and Krasnyy Ostrov, were only a few minutes by air from the salient. As Plocher says about the air battle at Kursk; "Yet, wherever German fighters appeared it was usually a relatively simple matter for the Luftwaffe to achieve local air superiority and even air supremacy over the Russians, even when the odds were very great."

Healy's claim the Soviets never believed it possible to disguise the advance of such a large force, is untrue. Rotmistrov, or whoever wrote his part of the fable, implies that the operation was a complete surprise to the enemy. Rotmistrov's book was one of the foundation documents of the fable, and what it said would have been widely believed by the Soviets.

Zamulin says: "The march would occur in two stages. At the end of the first stage, all three corps should close on the Oskol river, force a crossing of it, and assemble while waiting for their rear services and remaining equipment to move up to the designated areas." Then a second march to near Prokhorovka. [20]

Zamulin also states: "At 0130 on July 7, the (5th Guards Tank) army moved out.... the 29th Tank Corps was supposed to reach its assembly area (somewhere west of the Oskol River) at 1400, but it was late.... At the start.... had delayed its movement by three hours.... At the same time there were no bridges across the Oskol River that could support 50 to 60 tons of weight. Therefore, the General I. F. Kirichenko's brigades (the 29th Tank Corps and 25th Tank Brigade) didn't reach their assembly areas until 2030 on July 7 (seven and a half hours late after starting three hours late)." [21]

Get that!? There were no suitable bridges,... so the tanks arrived a few hours late.

If there were no bridges across the Oskol River that could support 50 to 60 tons then the Staryi Oskol rail bridge must have been out of operation. Zamulin doesn't bother to say where the 5th Guards Tank Army crossed the river, or the type of bridge, or how the Soviets built a new bridge, and transferred 40,000 men, 850 tanks, untold artillery guns, untold flak guns, and untold numbers of support vehicles, in just a few hours, or why the Germans never bombed this bridge, nor the armored columns that crossed it, nor even attempted to do so. The current state of the myth is somewhere beyond unbelievable. There were no suitable bridges across the Oskol River,... so the tanks were a few hours late. Truly unbelievable.

So, how did the armored columns cross the Oskol river? They didn't. They never existed.

The change to a march may have been convenient, but it introduced many difficulties.

The road infrastructure of the whole march area was extremely primitive. [22] There was no regular military traffic along these roads so they would have been in their original unimproved state. The military, like everybody else, used the railways. People and goods either crossed the rivers by rail or were ferried across. Since no road bridge could handle the weight of the tanks (about 30 tons for the T-34 and 40 tons for the KV-1), every stream had to be forded and every river, without a convenient rail bridge, had to be bridged. Even fording streams, or crossing swampy ground, would not always be a simple task, for hundreds of vehicles would churn up so much mud that trucks and tanks would get bogged. Building bridges, dealing with bogged vehicles, and break-downs, all takes time. Much, much more time than the three days the fable tells us the march took. Actually, according to the fable, the march itself took less than two days, as the 5th Guards Tank Army rested on July 8.

A column of tanks on the move in open country is particularly vulnerable to attack by aircraft. This is mainly due to the fact that flak guns are either, not available at all, or take too long to set up for defense. And even when flak guns were many, and ready, they were still regularly attacked and silenced by aircraft, but in this case the attackers would expect to take casualties. Fighter aircraft could theoretically provide protection, but the German pilots had little respect for the Soviet pilots. As Hermann Plocher says:

"As always, German flyers were far more impressed by the enemy's light antiaircraft and small arms fire than by Soviet fighters, which seldom showed themselves when German bombers had a good fighter escort."

Here is what the Stuka pilot, Hans-Ulrich Rudel, had to say about action at Kursk. [23]

"While the cannon-carrying aircraft (Ju 87G-1 Stukas) go in to attack, a part of the bomber formation (standard Ju 87 Stukas and others) deals with the ground defences; the rest (fighters) circle at a fairly low level like a broody hen round her chickens in order to protect the anti-tank aircraft from interception by enemy fighters."

"We have always to try to hit a tank in one of its most vulnerable places. The front is always the strongest part of every tank; therefore every tank invariably tries as far as possible to offer its front to the enemy. Its sides are less strongly protected. But the best target for us is the stern. It is there that the engine is housed, and the necessity for cooling this power centre permits of only a thin armour plating. In order to further assist the cooling this plating is perforated with large holes. This is a good spot to aim at because where the engine is there is always petrol. When its engine is running a tank is easily recognizable from the air by the blue fumes of the exhaust. On its sides the tank carries petrol and ammunition. But there the armour is stronger than at the back."

Will Fowler has this to say about the Ju 87G-1 Stuka: [24]

"The Ju 87G-1 was one of the marks of the slow but battle-proven, 11.5m (37ft 8in) long, 6600kg (14,550lb), two-seater, single-engined Ju 87 Stuka. This antitank version saw action almost exclusively in the East until the end of hostilities.... The armament was formidable: two fixed forward-firing 37mm (1.5in) BK 3.7 (Flak 18) cannon underwing and one flexible MG 15 in the rear cockpit. The cannon could easily punch through the thin deck armour of Soviet tanks. Powered by one 1400hp Junkers Jumo 211J-1 engine, it had a maximum speed at 4100m (13,500ft) of 410km/h (255mph) and a maximum range of 1535km (954 miles).... Stuka pilots like Rudel used the powerful armament to attack Soviet tanks, aiming at the thin armour of rear deck. Hits normally destroyed the tank or immobilized it."

This brings up another question:

Why weren't the armored columns destroyed by German aircraft?

Not only weren't the armored columns destroyed by aircraft, but there is no record of any attack at all. There is no record of a single tank or gun of the 5th Guards Tank Army being destroyed by enemy fire while on route.

Let's look at some of the reasons given:

The armored columns simply weren't spotted.

"The successful use of the element of surprise also deserves attention. It was a considerable achievement of Rotmistrov and his staff to bring an armada of tanks and other vehicles to the front so quickly and almost unnoticed. It required a march of 330 to 380 kilometres in three days." [25]

The three armored columns were each (supposedly) around 24 kilometers long. Frieser is saying that German reconnaissance was worse than incompetent. This is not believable.

Zamulin says: "It was simply impossible for the German aerial reconnaissance flights not to notice the continuous columns of equipment, which extended for many kilometers and were moving in daylight hours toward Prokhorovka." [26]

Fear of Soviet air power kept the Luftwaffe away.

George Nipe says: "Since it (the 5th Guards Tank Army) moved on an axis that was twenty-five to thirty kilometers wide, it was impossible to hide the advance from the German reconnaissance planes. The Soviet command realized that the Germans would detect the army and provided additional air support to counter expected air attacks. Evidently, this measure was successful because Rotmistrov was able to cover the distance without significant losses (read zero) in vehicles." [27]

The Germans had air superiority over the Kursk salient for the entire offensive. They established air superiority by shooting down hundreds of Soviet aircraft in the first few days. This clearly demonstrates that they were not afraid of the Soviet air force. The Germans constantly had their better fighter pilots in the air looking for Soviet fighters to engage with. If these pilots knew of a congregation of Russian aircraft, they would have gathered their friends and gone after it (even if it was a hundred kilometers from the salient). Once these aircraft were dealt with, they would have called up the Stukas and dealt with any armor the Soviet fighters were supposedly protecting. [28]

Anyway, even if they were fearful of Soviet air power, they would have still attacked.

The armored columns were spotted but the Germans were too busy.

"Luftwaffe reconnaissance was reporting large and increasing Soviet armored forces moving west and south, toward the Psel. Official doctrine and common sense alike called for an all-out effort to interdict the movement. The Luftwaffe had been originally configured for just that type of mission. But the need for direct ground support had so intensified that no aircraft could be spared from the front lines." [29]

Tanks in open country without flak support are basically waddling ducks waiting for aircraft to destroy them. If the Germans didn't attack the tanks when they had little, or no, flak support they would have to deal with them later when they joined the front and had good flak support. Not believable.

It should be emphasized that while protecting these mighty tank columns the other 100% of Soviet aircraft were attacking German armor in the Kursk salient.

Glantz and Orenstein give the following table of the daily number of daytime air sorties. [30]

Image

We consider the (contradictory) versions of the 5th Guards Tank Army's approach to Prokhorovka separately.

When the 5th Guards Tank Army approaches Prokhorovka from the north, we are told it does so by the end of July 9. On July 9 the Soviets flew only 845 sorties (as opposed to 1,185 the day before), not exactly providing additional air support.

When the 5th Guards Tank Army approaches Prokhorovka from from the east, it does so mainly on July 11. On July 11 the Germans flew only 528 sorties (as opposed to 1,105 the day before). Flying only 528 sorties on the 11th shows that the Germans had many aircraft sitting around that could have attacked the approaching columns.

When the 5th Guards Tank Army approaches from the north to the Bobryshevo, Sredniaia Ol'shanka, and Marino region, and later concentrates east of Prokhorovka, the armored groups travel on both July 9 & July 11 and are thus open to attack, and in need of protection, on both days. So, once again the air activity does not match the fable.

Note that on, July 12, the day of the "greatest tank battle ever", neither air force bothered to put in a big effort.

Anyway, all this doesn't matter, because everyone knows the Germans would have attacked the approaching columns. The fact that we are told that they did not, simply tells us we are being told a lie.

I have recently come across the book The German Air Force Versus Russia 1943, by Hermann Plocher and Harry Fletcher. During the Kursk offensive, Plocher was the commander of the 4th Air Division of Luftflotte 6 (Sixth Air Fleet), the air force assigned to work with Army Group Center. Here are a few quotes from his chapter on the Kursk offensive:

Page 60: "Regardless of the decisions the German Supreme Command might take with respect to the conduct of operations in the East in 1943, it was clear at the end of April that the Sixth Air Fleet had to take decisive action against the assembling and concentrating of Soviet armies, mainly by striking enemy road and rail movements as well as airfields situated within the Red Army's concentration areas. On 12 May the Luftwaffe attacked by day and night a number of troop concentrations, enemy rail targets and air bases, and, five days later in both Combat Zones South and Center, destroyed a large number of Soviet transport aircraft and several important rail depots. On 21 May German air units bombed and strafed Soviet troop concentrations, transport trains, and supply dumps in all of the probable areas of enemy main effort. Wherever reconnaissance planes detected important Russian activity German air forces made concentrated surprise attacks and, as a rule, achieved very good results. If key railroad bridges or thoroughfare axes could be destroyed, the resulting jam-ups would force troop and supply trains to come to a stop in the open, where they would be quickly dispatched by German flyers. By day or night, whenever weather and visibility permitted, special aircraft were sent out to attack railway trains, even those at extreme ranges. These single plane attacks interfered seriously with the Russian concentration and supply operations."

Page 66: "By exploiting various factors such as timing, prevailing weather conditions, and visibility in order to achieve surprise, by frequently changing objectives, and by combining high and low altitude attacks with fighter escort operations, the Sixth Air Fleet succeeded in seriously disturbing the detected Soviet concentration movements in the Kursk-Sukhinichi sector during April, May, and June. In the course of these operations the Luftwaffe inflicted very heavy personnel and materiel losses upon Russian units and even compelled them to move their railheads farther to the east, approximately to the Kastornoye-Livny-Shchigry area. This, in turn, forced the Red Army to make time-consuming overland marches, which proved to be extremely costly because these forces were then exposed to repeated German air attacks."

Page 77: (During the Kursk offensive) "All air units were to be used exclusively in tactical support missions, against targets within the battle area, the strongly developed Soviet defense positions, and Soviet artillery emplacements. Rail and road targets were to be attacked only if large transport movements were observed."

Page 85: "As always, German flyers were far more impressed by the enemy's light antiaircraft and small arms fire than by Soviet fighters, which seldom showed themselves when German bombers had a good fighter escort."

Page 99: (During the Orel counter-offensive the Luftwaffe could not find the enemy so they attacked railheads and installations instead) "It was practically impossible, however, to detect and interdict Russian troop units moving through the woods. Repeatedly the Luftwaffe struck Soviet railheads around Sukhinichi and attacked rail installations and trains along the Kozelsk and Kaluga areas in order to interrupt the forward flow of supplies and reinforcements. Nevertheless, no noticeable results were achieved...."

You can download Hermann Plocher's book from here.

Unlikely Hollywood-like episodes have been added to the fable.

Entertaining Hollywood-like episodes have been slipped into the records of both sides in order to add "authenticity" to the fiction. The most famous being Rotmistrov's mini-myth about Aleksandr Nikolayev who jumped into a burning tank, and crashed it into a German Tiger just before it exploded, destroying both tanks. The German version has the Tiger backing up a few meters and the explosion doing little damage to the Tiger. Both narratives are fiction.

The enormity of the Soviet defeat at Prokhorovka is not believable.

The narrative of the revised myth is so unlikely that it has needed to be helped by a multitude of stories; How the Soviets so rushed their counteroffensive that they forgot about their own antitank ditch and their tanks piled into it like lemmings. How the Tiger tank was so deadly that Rotmistrov schooled his drivers to race in and shoot at point blank range, a suicidal tactic. How the Soviets imagined hundreds of Tiger tanks before them when there were only four. How the formerly formidable T-34 was now simply a death trap,... etc, etc.

The whole counteroffensive was conceptually flawed.

Actually, the whole counteroffensive (of which the battle at Prokhorovka was a part) was devised without any consideration of military worth, so it is not surprising that it had no military worth. Prokhorovka was a fictional battle with a scripted Soviet win. The revised fable was the same fictional battle with a German win. Christopher Lawrence has this to say about the counteroffensive:

"The concept of smashing headlong, in a broad general offensive across the entire front of an attacking opponent, must be questioned at its most basic level. Exactly what was the purpose and use of such an attack? First, why would one attack everywhere, when parts of the line are better defended than other parts? Why not attack where you think the enemy is weak, instead of everywhere? Second, why not concentrate your offensive forces at the critical areas you want to attack? Therefore, you will get the best outcome from the attacks and may have enough weight to continue the attack in case the enemy position is penetrated. Third, why attack in the areas where the enemy is attacking? As the self-educated U.S. Civil War General Nathan Bedford Forrest so eloquently stated, 'Hit them where they ain't.' Work on the enemy's flanks, not across their front, into the face of their attacking forces. Fourth, why attack at all? The Germans were still attacking across the front with their three armored corps. Why not wait until their attacks had truly run out of steam? Attrite them before counterattacking.... It was an attack that was unnecessary, mindless in execution and did nothing but waste lives." [31]

Over the last few decades the original fable has been proved to be a work of fiction. The revised fable is just the original rewritten, with some unimportant details, such as who won the battle, changed. If the original was a work of fiction, why should the revised fable, which has been built upon it, be any different?

The Germans involved knew nothing of this "greatest tank battle ever".

The German operational records know nothing of the "greatest tank battle ever".

I had imagined that the German operational records for July 12 would be either mutilated beyond belief, or unaccountably missing. However, I was wrong. The July 12 records apparently exist, they are simply not believed.

"German loss claims (for the battle of Prokhorovka) have reached as low as 80 or into the hundreds, including 'dozens' of 'Tigers'. So, the German official loss record — 3 (!) tanks is very hard to believe!!!" [32]

"The files in the German archives, in which historians were strangely uninterested until a few years ago, contain meticulous assessments of Army Group South's tank losses. Examination of those files results in the conclusion—as surprising as it is unequivocal—that, on 12 July, II SS Armoured Corps (same as SS Panzerkorps) did not record a single writeoff for battle tanks and assault guns. This is also confirmed by the corps' logistics files, for example, an entry in the war diary of the quartermaster's department on the evening of 12 July: 'Dept. V informs the Quartermaster that there are no tank write-offs today.' Admittedly, the evaluation of other sources leads to the conclusion that three tanks left immobilized on the battlefield could not subsequently be recovered because of enemy fire, so that the write-off figures had to be adjusted later. But even if those losses are backdated to 12 July, that still gives a maximum total of three write-offs." [33]

The SS Panzer Corps suffered no tank losses on July 12 (the day of the "greatest tank battle of all time") simply because the SS Panzer Corps had run out of opposition. There was now no significant opposition in the Prokhorovka corridor all the way to Kursk. No opposition all the way to Kursk, but then there was Hitler.

The commander of the 4th Air Division knew nothing of the "greatest tank battle ever".

The myth states that aircraft played a large part in the battle. For example:

"The pyres of many shot-down German and Soviet aircraft also began to litter the battlefield, adding to the wrack of shattered armour that lay across the scorched, blasted and blackened wheat fields to the west of Prokhorovka." [34]

"At the same time over the battlefield furious aerial combats developed. Soviet as well as German airmen tried to help their ground forces to win the battle. The bombers, ground-support aircraft, and fighters seemed to be permanently suspended in the sky over Prokhorovka. One aerial combat followed another." [35]

Yet, Plocher, the commander of the 4th Air Division, never mentions the "greatest tank battle ever", or air support for this battle, in his chapter on air operations over Kursk. And, he was there. Also, recall (from above) that the number of Soviet & German air sorties for July 12 directly contradicts any particularly large battle on that day.

The SS Panzerkorps knew nothing of the "greatest tank battle ever".

"A report signed by the operations chief of the II SS Panzer Corps on the evening of 11 July, makes no mention of any buildup of forces in the Prokhorovka area. If he knew of any buildup he would have certainly mentioned it." [36]

Erich von Manstein called Kusrk "a victory thrown away".

At Kursk, Field Marshal Erich von Manstein was the commander of Army Group South.

"Victory on the southern front of the Kursk salient is within reach. The enemy has thrown in nearly his entire strategic reserves and is badly mauled. Breaking off action now would be throwing away victory!" [37]

"Speaking for my own Army Group, I pointed out (to Hitler) that the battle was now at its culminating point, and that to break it off at this moment would be tantamount to throwing a victory away." [38]

Theodor Busse, Chief of Staff, Army Group South, called Kursk "a victory".

"Only Theodor Busse, three years after the fall of Berlin, could refer to the battle of Kursk as a 'victory'." [39]

Friedrich Fangohr, Chief of Staff, Fourth Panzer Army, stated that victory had been immanent.

"Yet final, decisive Russian defeat had been in the offing at the very moment that it became necessary to discontinue the offensive." [40] Of course, it was not necessary to discontinue the offensive.

Overall German losses are inconsistent with the Kursk fable.

"Up to and including 14 July (one day after Hitler halted action by the northern group), Model's Ninth Army lost 41 battle tanks, 17 assault guns, and 19 tank destroyers. The total losses of Army Group South, up to and including 16 July, when Hitler finally terminated the offensive, were 161 tanks and 14 assault guns. Interestingly, only 10 Tigers were lost during the whole of Operation Citadel." [41]

Many authors believe that the Germans were on the edge of victory.

"By day's end on 9 July, the breach created by Totenkopf in the last line before the Psel suggested that within hours the Germans would achieve the very thing that the deep Soviet defences in the southern part of the salient had been designed to prevent–the crossing of the river and the break-out into open country by the surviving panzers. The strength of 1st Tank Army and 6th Guards Army was diminishing rapidly. All of the senior Soviet commanders on the Voronezh Front considered that if the Germans succeeded in breaking through the defensive belts to the steppe land beyond, this would constitute a victory for von Manstein in the south, no matter what the fortunes of Ninth Army in the north of the salient were." [42]

"A successful breakout over the Psel by 4 Panzerarmee and Armee-Abteilung Kempf toward Kursk thus would have been unopposed by a Soviet strategic armored reserve. Such a German advance would have cut off the Russian armies in the western section of the bulge, which included the remnants of 1st Tank Army and 6th Guards, 40th, 60th, 65th, and 38th Armies. More importantly, an advance to Kursk would have put the Germans in a position to strike the rear of the Bryansk and Central Fronts at Orel, which were at that time fully occupied with attacking Kluge's Heeresgruppe Mitte. Had the two Soviet fronts been threatened from the rear or flank while facing Kluge, it would have presented great difficulties for the Russians." [43]

But, these authors believe that the day was saved by the imaginary 5th Guards Tank Army. However, it was not the imaginary 5th Guards Tank Army that saved the Soviets. Hitler saved them. Hitler simply ordered Army Group South to withdraw. The imaginary 5th Guards Tank Army was invented to save Hitler.

"But then on 13 July Hitler summoned Manstein and Kluge to his headquarters where he told them that the Allies had invaded Sicily on 10 July and he was therefore calling off Zitadelle to send reinforcements to Italy and the Balkans. Manstein was furious; he believed Army Group South was winning the battle against the two Soviet tank armies and just needed time to finish the job. But his protestations were to no avail – Hitler ordered that the SS Panzerkorps be transferred to Italy. Manstein had no choice but to withdraw his forces to their start point in Belgorod." [44]

If Manstein had been allowed to continue, the Soviets would have suffered a catastrophic defeat. Thus they had to roll out their most powerful weapon, Hitler. The magnitude of the looming defeat was so large, that once again, it was necessary to play the Hitler card. Both versions of the fable were, and still are, simply to provide cover for Hitler's order that Army Group South withdraw moments after the battle had been won, before the Germans could reap the rewards of victory, before the Soviets suffered a catastrophic defeat. It was Dunkirk all over again, except worse. Of course, it was of extreme importance that Hilter not be exposed as the enemy. Thus the Prokhorovka fable was fabricated, and even when parts of the fable were found to be pure fiction, it was simply retold, with changes that left the important features unchanged. Hitler, by ordering the retreat of Army Group South, and by stripping it of its most important divisions when it became apparent that Manstein was not inclined to call off the attack, managed to change a victory into a defeat. The turning point of world war two.

So, there you have it. Proof that the world's greatest tank battle never happened.

Notes:

[1] Frieser, Karl-Heinz. Germany And The Second World War Volume VIII. The Eastern Front 1943-1944: The War In The East And On The Neighbouring Fronts (2017). p121. "However, since SS Armoured Infantry Division 'Totenkopf' was attacking northwards on that date (July 12) on the far side of the River Psel, there remained only SS Armoured Infantry Divisions 'Leibstandarte' and 'Reich', with a total of 117 battle tanks, 37 assault guns, and 32 tank destroyers, that is, 186 fighting vehicles in all, which could be deployed against 5th Guards Tank Army."

[2] Rotmistrov, Pavel. Tankovoye srazhenie. p21. "It required a march of 330 to 380 kilometres in three days."

Forczyk, Robert. Kursk 1943 The Southern Front (2017). p66. "Rotmistrov's 5th Guards Tank Army was just completing an impressive 400km road march on its own tracks and was assembling 15km north of Prokhorovka."

Zamulin, Valeriy & Britton, Stuart. Demolishing the Myth: The Tank Battle at Prokhorovka, Kursk, July 1943: An operational narrative (2011). p166. "As a whole, the almost 380-400 kilometer movement of the (5th Guards) tank army over the course of 6 to 9 July proceeded in an organized fashion."

Nipe, George M. Decision In The Ukraine (2012). c2. "Because of the critical nature of the situation on the Psel, Rotmistrov moved his army by day and night, at maximum speed from its assembly areas just west of the Don River, which was approximately 200 miles from Prochorovka. The army had to cover so much a distance in the short time allotted to Rotmistrov that he could not take the normal precaution of travelling only at night. Since it moved on an axis that was twenty-five to thirty kilometers wide, it was impossible to hide the advance from the German reconnaissance planes. The Soviet command realized that Germany would detect the army and provided additional air support to counter the expected air attacks. Evidently, this measure was successful because Rotmistrov was able to cover the distance without significant losses in vehicles. It is possible that due to the demands on the Luftwaffe in the combat areas on the north and south flanks of the salient, there were few planes to spare that could be used to attack the 5th Guards Tank Army route of travel."

Nipe, George M. ibid. c2. "The 5th Guards Tank Army was made up of the 18th and 29th Tank Corps and 5th Guards Mechanized Corps. In addition, the 2nd Tank Corps and 2nd Guards Tank Corps were attached to Rotmistrov's army by 11 July. Most authorities agree that the 5th Guards Tank Army, including the two attached tank corps, probably had 850 tanks, of which 500 were T-34s. The rest were lighter T-70s and a few Lend-Lease Churchill tanks. The Soviet tanks had barely arrived in time to prevent the capture of the town by the Germans."

Healy, Mark. Zitadelle: The German Offensive Against The Kursk Salient 4-17 July 1943 (2010). c41. "The paper strength of Rotmistrov's command did indeed appear formidable, with tank numbers considerably in excess of those of the SS Panzer Corps. Fallout from his command due to mechanical breakdowns on the march to the Kursk battlefield had been low. In consequence, he could field from among his five Corps 793 tanks, 501 T-34s, 261 T-70s, and a 'heavy' tank detachment of 31 British supplied Churchill MK IV tanks with the 18th Tank Corps, and 37 self-propelled guns. Another 21 KV-1s tanks were available with the 53rd Guards Independent Tank Regiment. Totals therefore amounted to some 850 tanks available to Rotmistrov as of dawn on 12 July."

Schranck, David. Thunder At Prokhorovka: A Combat History Of Operation Citadel Kursk July 1943 (2013). c8. "At 0130 hrs, Rotmistrov's 5th GTA was driving west but was still 150 miles away from Prokhorovka. The 18th TC and 29th TC were driving down parallel roads in the lead while 5th GMC was trailing in second echelon. Each convoy was 15 miles long." Note that this seems to imply three columns of 15 miles, and two crossings of the Oskol River.

Schranck, David. ibid. c16. The 5th Guards Tank Army also had 40,000 men to add to the offensive.

[3] Zaloga, Steven. Armored Champion: The Top Tanks Of World War II (2015). p185.

[4] ibid. p213.

[5] Schranck, David. ibid. c12.

[6] Forczyk, Robert. ibid. p66.

[7] Healy, Mark. ibid. c36.

[8] Glantz, D. & Orenstein, H. The Battle For Kursk 1943. The Soviet General Staff Study (1999). p220.

[9] Schranck, David. ibid. c3. "The 5th Guards Tank Army which was stationed over 200 miles away was ordered closer to Kursk and by the next evening was pulling into Staryi Oskol to the southeast of Kursk."

[10] Glantz, D. & Orenstein, H. ibid. p5.

[11] ibid. p90.

[12] Carell, Paul. Scorched Earth. The Russian-German War 1943-1944 (1970). p78. "General Katukov, the C-in-C of the reinforced Tank Army, was in a spot. Following the collapse of the Soviet Sixth Guards Army he was to have made a counter-attack with all available forces, but at the same time he was expected to bar the German advance towards Oboyan. And now, to top it all, he was being hard pressed himself. He had no choice but to employ his strategic reserves, which were being supplied to First Tank Army for its intended counter-offensive, one by one, as they arrived. The result was disastrous. On 11th July not only the Sixth Guards Army was knocked out, but First Tank Army was badly battered, and the hurriedly brought up Fifth Guards Army was frittered away piecemeal."

[13] Healy, Mark. ibid. c36.

[14] Schranck, David. ibid. c12.

[15] Nipe, George M. ibid. c2.

[16] Glantz, D. & Orenstein, H. ibid. p90.

[17] Zamulin, Valeriy & Britton, Stuart. ibid. p168.

[18] Glantz, D. & Orenstein, H. ibid. p90. & map 9 p83.

[19] Healy, Mark. ibid. c34.

[20] Zamulin, Valeriy & Britton, Stuart. ibid. p163.

[21] ibid. p166.

[22] Plocher, Hermann; Fletcher, Harry R. The German Air Force Versus Russia 1941 (1965). p14. "Soviet communication networks were extremely thin compared with networks in western Europe. Only three percent of Russian roads had any type of stone surfacing and most of the roads were absolutely unimproved. Her railroad network was somewhat better, but throughout the entire Soviet Union only 52,000 miles of railroad tracks had been laid by 1941. Yet this was sufficient to make it Russia's most reliable means of transportation. Because of this fact, interdiction of Soviet rail lines was one of the prime objectives of the German Luftwaffe."

McCarthy, Peter & Syron, Mike. Panzerkrieg (2013). c4. "Even more alarming was the Russian terrain. What had been marked on German maps as major roads turned out in reality to be nothing more than dirt tracks. And the choking dust thrown up was clogging tank engines and prematurely shortening their lives. Another disturbing factor was that after even a brief shower, the tracks that passed for roads turned to a sticky morass that made all movement impossible until the sun re-emerged. In these conditions the tanks were just about getting by, but the wheeled supply transport couldn't keep up."

[23] Rudel, Hans-Ulrich. Stuka Pilot (1958). p86 & 89.

[24] Fowler, Will. Kursk The Vital 24 Hours (2005). p160.

[25] Frieser, Karl-Heinz. ibid. p156.

[26] Zamulin, Valeriy & Britton, Stuart. The Battle of Kursk: controversial & neglected aspects (2017). p279.

[27] Nipe, George M. ibid. c2.

Schranck, David. ibid. c10. "To prevent the Luftwaffe from destroying the tank column, Stalin sent air cover the whole way to Prokhorovka from the Oskol River area."

[28] Plocher, Hermann; Fletcher, Harry R. The German Air Force Versus Russia 1943 (1967). p87. "The general impression in German circles was that the Russians were always able to make up their heavy losses and maintain their numerical strength through the receipt of replacement aircraft and the assignment of new personnel. Yet, wherever German fighters appeared it was usually a relatively simple matter for the Luftwaffe to achieve local air superiority and even air supremacy over the Russians, even when the odds were very great." Plocher was the commander of the 4th Air Division at Kursk.

Showalter, Dennis E. Armor And Blood: The Battle Of Kursk (2013). c5. "As early as July 7, almost half of VIII Air Corps's combat planes had been assigned to Model's sector. For July 10, all the medium bombers were also assigned to Model, and a large number of fighters were sent to conduct sweeps over the Soviet airfields supporting the Central Front. That meant that after five days, Manstein and Hoth could count on only a third of the air support originally available—and that was assuming Model's situation did not suddenly become desperate." Note that many of the airfields supporting the Central Front were outside the salient, and one assumes would have plenty of air cover. If the Germans were not shy to attack airfields outside the salient, they would not have been shy to attack the 5th Guards Tank Army on its march.

[29] Showalter, Dennis E. ibid. c5.

[30] Glantz, D. & Orenstein, H. ibid. p252.

[31] Lawrence, Christopher. Battle Of Prokhorovka: The Tank Battle At Kursk; The Largest Clash Of Armor In History (2019). p293 & 294.

[32] Domański, Jacek. Prochorowka 1943 (2007). p90.

[33] Frieser, Karl-Heinz. ibid. p129.

[34] Healy, Mark. ibid. c41.

[35] Carell, Paul. ibid. p83. Quoting Rotmistrov.

[36] Zamulin, Valeriy & Britton, Stuart. ibid. p280.

[37] Carell, Paul. ibid. p91. Translating Manstein.

[38] Manstein, Erich Von. Lost Victories (2004). c14. Translating Manstein.

[39] Newton, Steven H. Kursk The German View (2003). p6.

[40] ibid. p86.

[41] Frieser, Karl-Heinz. ibid. p183.

[42] Healy, Mark. ibid. c36.

[43] Nipe, George M. ibid. c2.

[44] McCarthy, Peter & Syron, Mike. ibid. c7.

Glantz and Orenstein's map.

Image

Glantz and Orenstein's map is from page 83 of their book, The Battle For Kursk 1943. The Soviet General Staff Study. It (supposedly) describes the maneuvering of the strategic reserves. It has been overlaid on a rail and road map.

A larger version of the above map is available.
The road map separately.
The rail map separately.
Glantz and Orenstein's map separately.
A larger version of the map below is available.

Image

The rail route from Rossosh, Kamenka, and Ostrogozhsk to Prokhorovka is shown in green.
The (unimproved dirt) roads from Rossosh, Kamenka, and Ostrogozhsk to Prokhorovka are shown in blue.

Some odds and ends:

Just some places I needed to look up.

Prokhorovka, Belgorod Oblast, Russia = Prochorovka = Prochorowka = Прохоровка = 51.03741, 36.73252
Kursk, Kursk Oblast, Russia = Курск = Курськ = 51.73733, 36.18735
Belgorod, Belgorod Oblast, Russia = Белгород = 50.61074, 36.58015
Oryol, Oryol Oblast, Russia = Orël = Орёл = 52.96508, 36.07849
Oboyan', Kursk Oblast, Russia = Oboian' = Обоянь = 51.20981, 36.27919
Veselyy, Belgorod Oblast, Russia, 309005 = Veselyi = Весёлый = 51.07271, 36.54324
Ostrogozhsk, Voronezh Oblast, Russia = Острогожск = Острогозьк = 50.8664, 39.07561
Rossosh, Voronezh Oblast, Russia = Rossosh' = Rossoshi = Россошь = 50.1912394,39.5258259
Valuyki, Belgorod Oblast, Russia = Waluiki = Валуйки = 50.2035, 38.1067
Pristen', Kursk Oblast, Russia = Mar'ino = Marino = Пристень = 51.23551, 36.69594
Kamyanka, Luhansk Oblast, Ukraine = Kam'yanka = Kamenka = Каменка = Кам'янка = 49.63719, 39.36498
Kamenka, Voronezh Oblast, Russia = Каменка = 50.71499, 39.42189
Voronezh, Voronezh Oblast, Russia = Воронеж = 51.67204, 39.1843
Krivonosovka, Voronezh Oblast, Russia = Krivonosovo = Кривоносово = 49.90969, 39.2644
Pisarevka, Voronezh Oblast, Russia = Kuzmenkov = Писаревка = 49.88545, 40.18519
Srednyaya Ol'shanka, Belgorod Oblast, Russia = Sredniaia Olshanka = Средняя Ольшанка = 51.14363, 36.5863
Verkhnyaya Ol'shanka, Belgorod Oblast, Russia = Vyshniaia Olshanka = Вышняя-Ольшанка = Psel = 51.09757, 36.70363
Rakitinka, Kursk Oblast, Russia = Bol'shaya Psinka = Ракитинка = 51.15293, 36.50004
Bobryshevo, Kursk Oblast, Russia = Bobryshëvo = Бобрышево = Бобрышёво = 51.21114, 36.43351
Prelestnoye, Belgorod Oblast, Russia = Прелестное = 51.03681, 36.61825
Stary Oskol, Belgorod Oblast, Russia = Staryy Oskol = Staryi Oskol = Старий Оскол = Старый Оскол = 51.29667, 37.84167
Tula, Tula Oblast, Russia = Тула = 54.19609, 37.61822
Yelets, Lipetsk Oblast, Russia = Elets = Елец = 50.6964, 38.0498
Kastornoye, Kursk Oblast, Russia = Kastornoe = Касторное = 51.8334, 38.1302
L'gov, Kursk Oblast, Russia = Льгов = 51.6888, 35.2843
Liski, Voronezh Oblast, Russia = Лиски = 50.98405, 39.51545
Kupiansk, Kharkiv Oblast, Ukraine = Kup'yans'k = Kupjansk = Куп'янськ = Купьянск = Купянск 49.71055, 37.61517
Tim, Kursk Oblast, Russia = Тим = 51.62222, 37.12444
Korocha, Belgorod Oblast, Russia = Короча = 50.8132, 37.18598
Vovchans'k, Kharkiv Oblast, Ukraine = Volchansk = Вовчанськ = Волчанск = 50.29078, 36.94108
Novyy Oskol, Belgorod Oblast, Russia = Novyi Oskol = Новый Оскол = 50.7633, 37.86402
Krasnyy Ostrov, Belgorod Oblast, Russia = Kraznyy Ostrov = Красный Остров = 50.94454, 37.78338
Yefremov, Tula Oblast, Russia = Efremov = Ефремов = 53.14806, 38.09924
Fatezh, Kursk Oblast, Russia = Фатеж = 52.0891, 35.8632
Ternovka, Belgorod Oblast, Russia = Терновка = 51.67803, 41.6375
Kastornoye, Kursk Oblast, Russia = Kastornoe = Касторное = 51.8334, 38.1302
Livny, Oryol Oblast, Russia = Лівни = Ливны = 52.42534, 37.60689
Shchigry, Kursk Oblast, Russia = Щигри = Щигры = 51.87555, 36.90432
Golubino, Belgorod Oblast, Russia = Голубино = 50.29078, 36.94108
Bol'shiye Seti, Kursk Oblast, Russia = Bol'shie Seti = Bolshie Seti = Большие Сети = 51.19966, 36.9064
Pristennoye, Kursk Oblast, Russia = Pristennoe = Пристенное = 51.20839, 36.82912
Glafirovka, Kursk Oblast, Russia = Глафировка = 51.17893, 36.80991
Kostroma, Belgorod Oblast, Russia = Krasnyy Oktyabr' = Krasnyi Oktiabr = 51.03353, 36.53346
Alexeyevka, Belgorod Oblast, Russia = Alekseevka = Алексеевка = 50.6309, 38.6903

Aleksandrovskiy = Aleksandrovski = Aleksandrovskii = Александровский is sometimes conflated with Prokhorovka. However, some authors treat it as a different locality.

The best way to locate a town, say Alexeyevka, is to enter the full name, Alexeyevka, Belgorod Oblast, Russia into Google maps. (Without the full name the locality is not always found.)

Other popular topics are:

The COVID-19 Hoax.
There are no ancient Jewish cities in Israel, but there are lots of ancient Greek cities.
WOW; Presidents Reagan, Clinton, Bush, Obama, and Trump are Jews.
The free Operating System Linux running Microsoft Operating Systems on Virtual Computers.
Proof that the name ADAM is of Greek origin.
preearth
 
Posts: 51
Joined: Tue Jun 08, 2010 5:52 am

Re: Proof that Adolf Hitler was a double agent.

Postby preearth » Mon Mar 30, 2020 12:39 am

The Covid-19 Scam & Vaccines.

A few Books.

The war on Ivermectin. The Medicine that could have ended the pandemic, by Pierre Kory.
The Real Anthony Fauci. Bill Gates Big Pharma and the Global war on Democracy and Public Health, by Robert F Kennedy Jr.
A Plague upon our House, by Scott Atlas. Scott Atlas served as a member of the White House Coronavirus Task Force and Special Advisor to President Trump. He relates an insider's view of events at the White House.

Latest Videos.

Joe Rogan interviews Robert F. Kennedy Jr. (Complete, Unedited Interview). 238M.
Tucker Carlson; Kennedy is winning. 24M.
Robert Kennedy; Endless war abroad brings violence to the Unites States. 20M.
Tucker Carlson & Mike Pence; Ukraine persecutes Christians. 12M.
Tucker Carlson & Mike Pence; Tanks for Ukraine, but nothing for you. 6M.

Here are a few videos concerning the Ukraine war and its causes. These express views that are much closer to the truth than the fairy tales the evil media tells you.

Ray McGovern (former CIA head of Russia desk) explains the U.S. role in the 2014 Ukraine coup. 40M.
Prof. John Mearsheimer (University of Chicago) states that NATO is totally U.S. run. 2M.
Mearsheimer predicts the (remarkedly foolish) U.S. policy will lead to Ukraine being wrecked (2015). 2M.
Mearsheimer looks at the causes and consequences of the 2014 Ukraine coup (2015). 93M.
Mearsheimer looks at the causes and consequences of the 2022 Ukraine war (2022). 74M.
India Today interviews Sergei Lavrov (the Russian Foreign Minister). 72M.
Gideon Rose (Editor Foreign Affairs magazine) on the Colbert Report 02/24/2014. 23M. Funny, in a tragic way.
Putin speaking at the Valdai International Discussion Club, 27 Oct. 2022. 277M 3:38:44 Full speech.

This Tucker Carlson interview with Todd Wood is amazing. 67M. Here are a few quotes:

"The Ukraine war is not about freedom, its not about Russia, even. Its about the deep-state wanting to protect this,... whatever you want to call it,... I call it the safe space for organized crime, where they can do anything they want to do, with no transparency, with no accountability,..."

"Zelensky is run by Kolomoyskyi, who is a Jewish oligarch who also pays for all the Azov & Pravyi sektor (neo-Nazi) battalions in the east." ... "the ones with all the swastikas,..."

My question is; Why are Jews like Joseph Biden, and Ihor Kolomoyskyi, funding Nazis?

It appears that in 2014 a group of religious Jews took over Ukraine. Instead of sticking to the well tried method of infiltrating both sides of the parliament, they threatened the elected leader, Yanukovych, who fled to Russia, and they assumed power in a violent coup. This was a mistake, as Ukrainians in the east mistook this coup for a neo-Nazi takeover, and refused to acknowledge the coup government as legitimate. This led to the civil war. If they had stuck to their old play-book they would probably now control all of Ukraine, and few would have noticed, or been able to do anything about, the change in power.

It is not clear who threatened Yanukovych but it was likely Tyahnybok's crowd. Tyahnybok himself is likely a Jew as he
1) is the leader of a neo-Nazi party,
2) conspired with the Jew Victoria Nuland (U.S. Under Secretary of State for Political Affairs), and
3) has won all (nine, or ten) court cases bought against him for inciting ethnic hatred.

It is notable that the 2014 coup government found positions for the Jew Arseniy Yatsenyuk (Prime Minister of Ukraine, 27 February 2014), the Jew Petro Poroshenko (President of Ukraine, 7 June 2014) and the Jew Vitali Klitschko (Mayor of Kiev, 25 May 2014) but no position was found for the (supposed) neo-Nazi Oleh Tyahnybok (Svoboda Party leader) when he lost his position in the parliament some months later (October 2014). Subsequently, the Jew Volodymyr Groysman (14 April 2016) became Prime Minister and the Jew Volodymyr Zelensky (20 May 2019) became President. So much for the fable of neo-Nazi's taking over Ukraine in a right-wing coup. The neo-Nazis just provided a smoke screen for the Jew takeover.

The Ukraine gambit appears to be an attempt to replay the second world war.

1933: We have a Jew takeover of Germany disguised as a Nazi takeover.

The takeover occurred when the Jew Hitler assumed dictatorial powers.

Leads to war against the Soviet Union.

2014: We have a Jew takeover of Ukraine disguised as a neo-Nazi takeover.

The takeover is already complete (except in the east).

Leads to war against Russia.

Seeing that many of the politicians in "neo-Nazi" Ukraine are Jews, or of Jewish descent, I wondered if the same may have been true in Nazi Germany. So, I checked the surnames of a large number of people from the Nazi era. What I found is truly amazing. Note that all surnames designated Jewish can be found in the books on Jewish Genealogy by Alexander Beider, Lars Menk, and Emanuel Elyasaf.

Adolf Hitler [Jew surname].

Below is a list of Nazi Field Marshalls.
Looks like they were all of Jewish descent.


Fedor von Bock [Jew surname].
Werner von Blomberg [Jew surname].
Walther von Brauchitsch = Brauch-itsch [Jew surname-son of]
Ernst von Busch [Jew surname].
Hermann Göring = Gör-Ring [Jew surname-Jew surname] Luftwaffe.
Wilhelm Keitel [Jew surname].
Albert Kesselring = Kessel-Ring [Jew surname-Jew surname] Luftwaffe.
Ewald von Kleist [Jew surname].
Gunther von Kluge [Jew surname].
Georg von Küchler [Jew surname].
Wilhelm Ritter von Leeb [variant of Jew surname Lieb?]
Wilhelm List [Jew surname].
Erich von Manstein [Jew surname]. Born Lewinski [Jew surname].
Erhard Milch [Jew surname] Luftwaffe.
Walther Model [Jew surname].
Friedrich von Paulus [variant of the Jew surname Paul?]
Walther von Reichenau [Jew surname]
Erwin Rommel [variant of Jew names Frommel and Trommel?]
Gerd von Rundstedt = Rund-stedt [Jew surname-town]
Ferdinand Schörner [variant of the Jew surname Tschorne?]
Hugo Sperrle = Sperr-le = [Jew surname-common suffix] Luftwaffe.
Erwin von Witzleben [variant of Witzler-ben? Jew surname-son of]

Those of Jewish descent in Hitler's life (non-military).

Martin Bormann [Jew surname]. Hitler's private secretary. Money man.
Eva Braun [Jew surname]. Hitler's mistress and wife.
Hans Frank [Jew surname]. Hitler's lawyer.
Ulrich Graf [Jew surname]. Hitler's personal companion 1920-1923.
Gertrud Junge [Jew surname] nee Humps. Hitler's private secretary.
Theodor Morell [Jew surname]. One of Hitler's personal physicians.
Karl Brandt [Jew surname]. One of Hitler's personal physicians.
Albert Speer [Jew surname]. Hitler's personal architect and city planner.
Fritz Wiedemann [Jew surname]. Personal adjutant to Hitler.
Julius Schreck [Jew surname]. Hitler's chauffeur.
Karl von Frank [Jew surname]. Hitler's genealogist.
Hugo Blaschke [Jew surname]. Hitler's dentist.
Hugo Erlanger [Jew surname]. Hitler's landlord for ten years.

Some other Nazi leaders.

Adolf Eichmann [Jew surname]. Head of the Scientific Museum for Jewish Affairs.
Rudolf Hess [Jew surname]. Deputy to the Fuehrer.
Heinrich Himmler [Jew surname]. Leading National Socialist politician.
Alfred Rosenberg [Jew surname]. Leading proponent of National Socialist ideology.
Julius Streicher [Jew surname]. National Socialist politician.
Wilhelm Messerschmitt [Jew surname]. Aircraft designer and manufacturer.
Hjalmar Schacht [Jew surname]. Financier, president of the Reichsbank.
Joseph Goebbels [variant of the Jew surname Göbel?] National Socialist politician and propagandist.
Reinhard Heydrich = Heyd-Rich [Jew surname-Jew surname] Administrator of the concentration camps.

Here is a list of the Nazi Chiefs of General Staff.
They were probably all of Jewish descent.


Heinz Guderian [Jew surname]. Chief of General Staff Jul 1944 to Mar 1945
Adolf Heusinger [Jew surname] Chief of General Staff Jun 1944 to Jul 1944
Kurt Zeitzler [variant of the Jew name Weitzler?] Chief of General Staff Sep 1942 to Jul 1944
Franz Halder [variant of the Jew name Halde?] Chief of General Staff Sep 1938 to Sep 1942
Ludwig Beck [Jew surname] Chief of General Staff Jul 1935 to Aug 1938

Various leaders.

იოსებ ჯუღაშვილი [variant of the Jew name ჯუდაშვილი] (Joseph Stalin) General Secretary of the Soviet Union; ჯუდაშვილი translated means "son of Judah".
Mikhail Gorbachev [variant of the Jew name Gorbaczyński?] President of the Soviet Union
Boris Yeltsin [variant of the Jew name Peltson?] President of Russia
Angela Merkel [Jew surname] nee Kasner [Jew surname] Chancellor of Germany
Olaf Sholtz [variant of the Jew name Shultz?] Chancellor of Germany
Annalena Baerbock = Baer-Bock [Jew surname-Jew surname] German Foreign Minister
Adolf Hitler [Jew surname] Chancellor of Germany
Franklin Roosevelt [variant of the Jew name Rosenfelt] President USA
George Bush [variant of the Jew name Busch?] President USA
Donald Trump [variant of the Jew name Trumpf?] President USA
Lech Kaczyński [Jew surname] President of Poland
Jarosław Kaczyński [Jew surname] Prime Minister of Poland
Mateusz Morawiecki [variant of the Jew names Morawiec Morawietz etc?] Prime Minister of Poland
Stepan Bandera [variant of the Jew surname Bander?] Ukrainian Nationalist
Volodymyr Zelensky [Jew surname] President of Ukraine
Volodymyr Groysman [Jew surname] Prime Minister of Ukraine
Denys Shmigal [variant of the Jew name Schmigelski] Prime Minister of Ukraine
Vitali Klitschko [variant of the Jew name Klitsch?] Mayor of Kiev
Mark Rutte [Jew surname] Dutch Prime Minister
Klaus Johannis [Jew surname] President of Romania
Giorgia Meloni [variant of the Jew name Melon?] Italian Prime Minister
Kaja Kallas [variant of the Jew name Challasch?] Estonian Prime Minister
Petr Pavel [Jew surname] Czech President; Chief of the NATO Military Committee
Jaap Scheffer [Jew surname] NATO Secretary General 2004-2009
Jens Stoltenberg [variant of the Jew name Stoltzenberg?] NATO Secretary General 2014-
Charles Michel [Jew surname] European Council President
Ursula von der Leyen [Jew surname] nee Albrecht [Jew surname] President of the European Commission

Here is a list of Jewish surnames taken from the following books:

Handbook of Ashkenazic Given Names and Their Variants by Alexander Beider
A Dictionary of Jewish Surnames from Galicia by Alexander Beider
A Dictionary of German-Jewish Surnames by Lars Menk
Handbook of Ashkenazic Given Names and Their Variants by Alexander Beider
A Dictionary of Jewish Surnames from Italy, France and "Portuguese" Communities by Alexander Beider
A Dictionary of Jewish Surnames from Maghreb, Gibraltar, and Malta by Alexander Beider
The Jacobi Papers: Genealogical Studies of Leading Ashkenazi Families by Paul Jacobi & Emanuel Elyasaf

General Surovikin and Prigozhin; Traitors.

The Russian General Surovikin (and associates) organized the withdrawal from Kherson (Ukraine).

The main reason Surovikin ordered Russian forces to withdraw was that the Russians had just comprehensively stopped the Ukrainian Kherson offensive. All was relatively quiet. Any counter-offensive would have punched a hole right through the Ukrainian lines, their forces would have been encircled, and destroyed. It was imperative that the Russians were pulled back before the precarious state of the Ukrainian forces became known.

At this time the Ukrainians were way overextended and were not able to fight this two front war. One front had to be closed down. As the front east of the Dnieper river was by far the stronger, Surovikin had the Russians abandon the front west of the Dnieper. To make sure that the Russians could not easily reopen this front, Surovikin had the southern bridges over the Dnieper blown up. That's right, Surovikin blew up the bridges useful to the Russians. Surovikin never touched the bridges that were of vital importance to the Ukrainians. In fact, the northern bridges over the Dnieper are all still standing.

Surovikin claims that the 30,000 Russian soldiers west of Kherson could not be supplied with the necessary ammunition, etc. This of course is total garbage, considering that they had just done exactly this in stopping the Ukrainian Kherson offensive. Surovikin's claim is simply a lie. Remember, back in February the whole 30,000 man army, with all its equipment, had crossed to Kherson within a couple of days. Similarly, when they withdrew. Thus in the weeks where the civilians were pulled out of Kherson, the 30,000 man army could have been heavily reinforced, and supplied with enough equipment to smash the Ukrainian forces, but, of course, this was not wanted.

Since there were no good excuses for pulling out of Kherson, Surovikin had to grasp at straws, suggesting that artillery/missile strikes could cause the sudden breaking of the Kakhovka dam, which would wash away the bridges, and trap the 30,000 man army west of the Dnieper. Of course, even thousands of hits on the dam would not result in catastrophic failure. A gradual uncontrolled leakage of water may have occurred, resulting in a short-term flooding of some areas but nothing that would wash away bridges. (And even if the bridges were lost it would be easy enough to resupply the men by landing craft, ferries, and other boats. Resupply by aircraft would likely be too dangerous.)

Another reason that the Russians were ordered out of Kherson is that the Ukrainians had no way to stop a determined advance toward Odessa. Without Kherson as a staging area the Russians would no longer have this option. If the Russians had tried to advance on Odessa they would have met minimal resistance. The reason the Ukrainians have to continually tell you how strong their forces are, is because they are not strong.

It is clear that as long as Surovikin (and associates) are in charge, there will be no Russian attempt to cut Ukrainian supply lines as the Ukrainian army would collapse in short time. The talk of a winter offensive to cut the supply lines is just talk. It will not happen as it would quickly lead to a Ukrainian defeat.

Surovikin will continue to claim that attacking into the teeth of the Ukrainian defenses is the only way to save Russian lives. As the Ukrainians sit in their concrete bunkers and mow down any exposed Russian forces, Surovikin will tell us that things have to be done this way, to save Russian lives. Any talk of finding one of the thousands of weak spots in the Ukrainian line, breaking through the line there, and attacking the concrete bunkers from the back, will be taboo. Since frontal attacks require wasting huge quantities of ammunition such attacks will probably continue till the Russians exhaust their supplies. The best tactic for destroying fortified positions will never be allowed.

And then Putin will give Surovikin a medal.

The last section was written before the Wagner group actually sought out weak spots in the Ukrainian line, and broke through there, with the intention of encircling their enemy, and, in the absence of surrender, attacking from the back. It is now clear that the winter offensive, with all its advantages, will not occur. The Russian high command is clearly waiting for the Ukrainian side to receive thousands more anti-tank weapons before any major offensive to cut supply.

If the Russian High Command controlled the Wagner Group they would have been ordered to withdraw already. And the Ukrainians would have staged another miraculous counter offensive. Just like in Kherson and east of Kharkov. But since the Russian High Command does not control the Wagner Group they will force them to withdraw by cutting off their ammunition. Then the traitors will hand the Ukrainians yet another miraculous counter offensive.

Prigozhin has said: "As for the supply of ammunition to the Wagner PMC, Akhmat, some other units have shared what they could. Generals who are around the leadership of the Russian military grouping sign documents for which afterwards they can be put in a jail cell by the Military Prosecutor’s Office, just to provide us [PMC Wagner] with ammunition, which we get directly from the wheels. At the same time, the Chief of General Staff and the Minister of Defense are giving orders to not only stop providing PMC Wagner with ammunition, but not even help us with air transport. Now I received information that they had even cancelled distribution of sapper shovel, so the guys could entrench themselves up. There is simply a direct opposition, which is called nothing else but an attempt to eliminate the Wagner PMC. This can be considered equal to treason against the Motherland. This comes at a time when the Wagner PMC is fighting for Bakhmut, losing hundreds of its fighters every day."

Some days later, Prigozhin said in a message posted on his Telegram channel, "In order to stop me from asking for ammunition, they turned off all special [government] phone lines in all of the offices and [Wagner] units ... and blocked all [my] passes to the agencies responsible for making decisions," He subsequently called on ordinary Russians to help him put pressure on the country's regular army to share their supplies of ammunition with Wagner fighters. "Now I can only ask [for more supplies] through the media and... most likely will be doing just that," Prigozhin said.

It seems that Prigozhin frustrated the Russian High Command's effort to save Bakhmut, and they are not happy. The traitors have plans to restructure the Wagner group into something more pliable. A group that will withdraw when told to withdraw.

In Feb 2023 it was reported that the Russians were only 3.8 km from physically cutting the only road in and out of Bakhmut. But this never happened. Why? This short video describes the state of the encirclement on 19 Feb 2023. In the video it was predicted that the battle for Bakhmut would be over in a few days. However, in late February, or early March, the fighting to complete the encirclement stopped completely. At this time all roads in and out of Bakhmut came under Russian fire control.

No one seems to know why the encirclement was halted.

Have the Russian traitors stopped the fighting so that the chosen can walk out and fight another day?

The preferred option was probably for the traitors to order a withdrawal allowing the Ukrainians to stage another miraculous counter offensive, just like in Kherson and east of Kharkov.

However, the Wagner Group refused to cooperate, so they cut off it's ammunition.

But even that did not work as Prigozhin was still able to get ammunition from Akhmat, and a few other units.

Eventually Prigozhin was reduced to calling favors that enabled him to get ammunition without it being processed directly through the Russian military. So the traitors took away his phones.

Since March 1, due to lack of ammunition, the Wagner group has not tried to close the encirclement of Bakhmut.

Prigozhin's promise that the Wagner group would take Bakhmut, in spite of the Russian MOD, was premised on his being able to find ammunition elsewhere. It appears that he was not able to do so. Thus his troops are wasting their time fighting for the small village of Orikhovo-Vasylivka, far to the north-west of Bakhmut.

How little interest the Russian High Command has in winning the war can be seen in the fight for the village of Orikhovo-Vasylivka. One notes that the main road from Chasiv Yar (Bakhmut) to Slavyansk passes only 3 kms from Orikhovo-Vasylivka and that the two are separated only by open fields and an irrigation canal that parallels the road. Not only that, but this road forks to Kramatorsk only 5 kms away. Yet no member of the Russian High Command has suggested to Prigozhin that he should have his men cut the roads. Perhaps Prigozhin should have done this himself, but he seems to have a problem with ammunition.

In recent days Prigozhin seems to have come to some arrangement with the Russian High Command whereby he gets the ammunition he needs as long as he doesn't use it to encircle Bakhmut. Of course, this arrangement will lead to the unnecessary death of hundreds of Russians, but this doesn't seem to be much of a concern. The unnecessary deaths being those incurred storming Bakhmut rather than encircling it and forcing a surrender (i.e., starving them out).

And, of course, many more Russian lives were lost when Prigozhin announced Wagner would take no prisoners.

Now there is another way of viewing the Prigozhin affair.

During April of 2023, Prigozhin, and co-conspirators in the Russian Ministry of Defense, organized what appeared to be a serious dispute between them, although, as one might expect, it was never exactly clear what this dispute was about. This sowing of discord was to provide a plausible excuse to completely withdraw the Wagner group from Bakhmut (the town the Russians call Artyomovsk) as the Ukrainians were losing badly to the Wagner fighters.

On April 30 Prigozhin (the Wagner spokesperson, often incorrectly called the head of the group) accused the country's military leaders of "high treason" for not providing his group with ammunition, and threatened to withdraw Wagner from Bakhmut if it didn't receive more ammunition.

On May 5 Prigozhin stated that Wagner would pull out of Bakhmut on May 10. He stated this even though he had recently predicted that the (long delayed) Ukrainian counter-offensive would begin by 15 May. Thus, it is was somewhat likely, according to him, that the Ukrainian counter-offensive would occur after Wagner had been withdrawn, or as Wagner was being withdrawn. A Russian Patriot could hardly have missed that this might occur, and would not have planned a May 10 pullout. Yet Prigozhin does not even notice the problem. It is evidently not a concern of his.

In the evening of the next day the Ministry of Defense promised that the Wagner group would get all the arms they needed. Not having a sufficient excuse to pull Wagner fighters out, they stay, and fight, until May 20, when Wagner declared victory in Bakhmut. However, what was victory in Bakhmut? Victory in Bakhmut was simply the pushing of the Ukrainian army out of the contiguous suburbs of Bakhmut into the area west and south-west of the city. So, victory in Bakhmut, left intact most of the army that had been in Bakhmut, only now it was positioned west and south-west of the city, where much of it remains to this day. So even though we are told that the fight in Bakhmut is over, it actually still goes on.

On May 25 Wagner began their withdrawal from Bakhmut, and the transfer of positions to the Russian army. This was completed by June 1. So, the traitor Prigozhin had been able to arrange for Wagner fighters to be completely withdrawn and replaced by supposedly less capable forces. Not only that, but the Wagner forces left no fortified lines. These had to be cobbled together by the replacement forces and held against the entire Ukrainian army that had withdrawn from Bakhmut, and was now west, and south-west, of the city. This they were able to do. See this short video by Alexander Mercouris. Wagner's withdrawal let the pressure off the remaining Ukrainian forces giving them time to stabilize their defenses and plan future offenses. This is a similar strategy to that used by the traitor Surovikin at Kherson, and east of Kharkov. In one case you win the battle for the enemy by ordering your own troops to withdraw. In the other, you have the enemy escape defeat, by ordering your own troops to withdraw.

Bakhmut demonstrated that the Wagner forces are the best assault forces in the world. The Ukrainians (Jews hold all positions of power) know this and have worked to neutralize them. This is what the Prigozhin protest/rebellion was all about. Prigozhin called it a protest (against poor/treacherous treatment by the Ministry of Defense), but western "observers" called it a mutiny and worked to turn it into a fully fledged rebellion. That it was not a mutiny is obvious. The so called "march on Moscow" (from Rostov-on-Don to Moscow) was a march of over 1,000 kms, so they had no chance of getting to Moscow, let alone fighting there. The plan of the Russian traitors was to use the protest/rebellion as an excuse to expel Wagner forces from Ukraine. This is what happened. Many ended up in Belarus. The coup in Niger is part of the same operation, by the same Russian traitors. The plan is to have what is left of Wagner sent to Africa. Wagner is to be permanently removed from the fighting in Ukraine. They are to be sent somewhere else, anywhere else, anywhere other than back to Ukraine.

So, where in the past have we seen the withdrawal of an army just after they had won the battle, so that they ended up losing. Yes, when Hitler ordered Manstein to withdraw just after he had broken through the southern front, and essentially won the world war two battle of Kursk. About that battle, Field Marshal Erich von Manstein, the commander of Army Group South said;

"Speaking for my own Army Group, I pointed out (to Hitler) that the battle was now at its culminating point, and that to break it off at this moment would be tantamount to throwing a victory away."

It truly seems that the mad Jews are trying to replay world war two.

And, back to Tucker Carlson's interview with Todd Wood.

"We know (about the bioweapons) because Bob Kagan's wife, Victoria Nuland (U.S. Under Secretary of State for Political Affairs), who's not very bright, that's the one good thing you can say about her,... she's dumb enough to say it out loud,... announced in the (March 8) senate hearing; Oh by the way we have biolabs in Ukraine. And it turns out we do,... but why?" ... "I have my suspicions,... what their intentions are you can guess,... we've had the Covid-19 pandemic,..."

Really? Covid-19 is obviously a genetically engineered virus, but was it created in Ukraine?

Tucker Carlson has a whole episode on the Ukrainian crisis and another on the bio-labs. Here, 114M and here 22M.

This 2014 video reports on the U.S. support of Ukraine neo-Nazis and their role in the coup. 37M.

And, back to Covid.

What a top idea. Peter McCullough, and friends, are creating an alternative medical establishment. For this, and more, see the interview of Peter McCullough with Alex Jones. 133M

Peter McCullough teams up with crime writer John Leake to write the book; The courage-to-face-covid-19. This video is an introduction to their book about the criminal enterprise that was Covid-19. 67M

Peter McCullough is interviewed by Charlie Kirk. Here. 32M

Jeff Hays' documentary film "The Real Anthony Fauci" based on Robert F. Kennedy Jr.'s best-selling book of the same name. A story of massive corruption in the U.S. pharmaceutical industry.

The Dec 2022 vaccine accountability roundtable. Florida Governor Ron DeSantis asks the Florida Supreme Court to investigate "any and all wrongdoing in Florida with respect to Covid-19 vaccines." Here. 160M.

Senator Ron Johnson conducts a forum titled, "Covid-19 Vaccines: What They Are, How They Work, and Possible Causes of Injuries." Speakers Include Dr. Peter McCullough, Dr. Pierre Kory, Dr. Paul Marik, Dr. Robert Malone, ICAN Attorney, Aaron Siri, Esq., OpenVAERS Founder, Liz Willner, Edward Dowd, Dr. Harvey Risch, Dr. Ryan Cole, Journalist, Del Bigtree, and more. Full coverage, 640x360 229M; 1920x1080 1.4G. Highlights, 640x360 13M; 1920x1080 81M.

The Covid vaccinations seem to be responsible for a massive surge in cardiac problems among young fit people. I can't recall where I found this video, about it, but here is a web-page; 1884 Athlete Cardiac Arrests, 1310 of them Dead, after Covid vaccinations.

The 2022 Global Covid Summit. We declare that Pfizer, Moderna, BioNTech, Janssen, Astra Zeneca, and their enablers, withheld and willfully omitted safety and effectiveness information from patients and physicians, and should be immediately indicted for fraud. We declare government and medical agencies must be held accountable. Here. 78M.

Senator Ron Johnson, Dr. Pierre Kory, Dr. Robert Malone, and Dr. Peter McCullough discuss the Covid Cartel, Crony Capitalism, Big Pharma, and Vaccines. Here. 122M (August 2022)

Bret Weinstein talks to Dr. Pierre Kory about Ivermectin and the criminal campaign against it. An excellent video. 189M

CDC (Centers for Disease Control and Prevention) accused of fraud. Here. 41M. The New York Times article.
Dr Robert Malone calls for imprisonment of the guilty. Here. 31M.
Tucker Carlson interviews Dr Robert Malone. Here. 89M.
Del Bigtree interviews Dr Peter McCullough. Here. 150M.
Vaxxed the movie by Del Bigtree (part of The Highwire episode 259). Here. 158M.
Dr Robert Malone presents "An Overview of mRNA Vaccine Technology." Here. 60M.
Interview with Dr Meryl Nass. Was the Covid-19 virus genetically engineered? Here. 64M.
Dr Merritt Lee's talk about VAERS (Vaccine Adverse Event Reporting System) at the White Coat Summit. Here. 23M.
Dr Ryan Cole; why are there no autopsies for vaccine deaths. Here. 23M.
Roundtable discussion with Charlie Kirk, Dr Pierre Kory, Dr Ryan Cole, and Dr Flavio Cadegiani. Here. 143M.
The curtain close on covid theater, hosted by Florida Governor Ron DeSantis. Here. 109M.
Governor Ron DeSantis' fight to make monoclonal antibodies, and other treatments, available in Florida. Here 68M here 5M, and here 60M.

This video 168M, and the accompanying pdf 30M, from Dr. Richard Fleming, are very good. Unfortunately, in the past I have ignored him, as I was told (incorrectly) he was pushing the "graphene oxide in vaccines" garbage.

Ryan Cole, Robert Malone, and Denise Sibley give testimony for Tennessee House Bill 1871, March 9, 2022. Here. 52M.

In the video, Dr Ryan Cole states; Those who have had the vaccine don't have that ability (to clear the virus), because they don't have these little IgA secretory mops in their tears nose and throat and that's why we have seen a lot of those who have gotten, one, two, three shots still get covid, because they don't develop a full broad immunity like a natural infection does. Cole is wrong here. If it was a lack of IgA antibodies that allowed the vaccinated to be infected (with covid-19), then the vaccinated would only be infected at the same rate as the un-vaccinated. However, the vaccinated are now being infected at more than triple the rate of the un-vaccinated. This calls for some other explanation. See below.

Dr Ryan Cole also states; This virus has intermediate hosts, meaning the virus can bounce back and forth between animals and humans, and animals and humans, so unless you stick a shot in every bat and every pangolin and every deer, white tailed deer like to house this virus in their nasal mucosa as well. There are too many animal reservoirs for this kind of virus. Cole is completely wrong here. Thorough investigation has not found any animal reservoir where the virus bounces back and forth between animals and humans.

Another must watch video:

Dr. Pierre Kory talks about the war on hydroxychloroquine, ivermectin, and other cheap drugs that treat covid-19. "It's not about ivermectin. It's about the pharmaceutical industry capture of our agencies, and how our policies are all directed at suppressing and avoiding the use of cheap, repurposed drugs" he says. Download here. 73M. Bigger picture here. January 29, 2022.

Here is the Jan 24 2022 Covid-19: A Second Opinion hosted by Senator Ron Johnson at the U.S. Senate. 640x360, 379MB. A group of world renowned doctors and medical experts provide a different perspective on the global pandemic response, the current state of knowledge of early and hospital treatment, vaccine efficacy and safety, what went right, what went wrong, what should be done now, and what needs to be addressed long term. I will leave this video up for a few weeks. A larger version can be watched here and downloaded from here.

Dr Paul Marik makes the case for Ivermectin in this video. 39M. Some excerpts: After penicillin, Ivermectin is the second most important drug ever produced. It has saved hundreds of thousands of lives across this planet... It is on the WHO's list of essential medicines... 3.7 Billion doses have been dispensed to humans, to human beings, not horses. This is a remarkable drug. It has broad spectrum anti-parasitic, effective against a whole bunch of parasites, and... it is very effective against RNA viruses: HIV virus, zika virus, influenza virus, SARS-CoV-2 virus. In addition, what makes this a truly astonishing drug,... is it is a potent anti-inflamatory drug. And if anybody knows about Covid, Covid goes through stages. A viral replicative phase to a profound inflammatory phase. That's why Ivermectin is unique (it is not unique, hydroxychloroquine has similar properties) in that it treats across the spectrum (i.e., at all stages) of SARS-CoV-2. It's safe and well tolerated... You'll see an 83% improvement in prophylaxis trials, 66% improvement in early trials, 34% improvement in late trials, a 52% reduction in mortality. It reduces mortality by half.

Here are two must watch videos:

Dr Peter McCullough on vaccine injuries, vaccine deaths and omicron. Download here. 129M. Bigger picture here.
Dr Peter McCullough on the suppression of hydroxychloroquine, ivermectin, and other covid 19 treatments. Download here. 132M. Bigger picture here.

You can download the Dec 31, 2021, Joe Rogan, Dr. Robert Malone, interview from here. 156 MB. In the video, Malone states that the Government of India did not disclose what was in the covid kits distributed throughout Uttar Pradesh. Be that as it may, the Indian national newspaper the Hindu explicitly stated, on May 12, 2021, that kits containing ivermectin were to be distributed throughout the states Goa and Uttarakhand.

You can download the Jan 6, 2022, Pierre Kory, Greg Hunter interview from here. 66M. Pierre Kory concludes that the regulatory agencies (NIH, CDC, NIAID, etc) have been captured. By the way, the distorted video, and background noise, etc, is mostly added by the evil people who work for the video distributors. In some cases it is actually (deliberately) added by those who produce the video.

Here is Pierre Kory on FOX news (Jan 9, 2022). 11M. He warns of the capture of American agencies.

There are many more videos below.

The conspiracy against chloroquine (and hydroxychloroquine).

Chloroquine and SARS.

Chloroquine is a potent inhibitor of SARS-CoV infection, and spread, in vitro.

We report, that chloroquine has strong antiviral effects on SARS-CoV infection of primate cells. These inhibitory effects are observed when the cells are treated with (clinically admissible concentrations of) the drug either before or after exposure to the virus, suggesting both prophylactic and therapeutic advantage.[51]

We report on chloroquine,.. as an effective inhibitor of the replication of the severe acute respiratory syndrome coronavirus (SARS-CoV) in vitro. Chloroquine is a clinically approved drug effective against malaria. We tested chloroquine phosphate for its antiviral potential against SARS-CoV-induced cytopathicity in Vero E6 cell culture... The IC50 of chloroquine for inhibition of SARS-CoV (8.8 ± 1.2 µM) in vitro approximates the plasma concentrations of chloroquine reached during treatment of acute malaria... Chloroquine, may be considered for immediate use in the prevention and treatment of SARS-CoV infections.[52]

In vitro, is Latin for "in glass." It describes experiments, on cells, that have been grown outside of a living organism, e.g., cells that are grown in a test tube or petri dish. In vivo, is Latin for "within the living." It describes experiments, on cells, that are part of a whole living organism, such as a person, animal, or plant. The mentioned IC50 is the amount of chloroquine needed to inhibit SARS-CoV virus reproduction by 50%.

Chloroquine prevents terminal glycosyaltion of the ACE2 receptor.

These data provide evidence that ACE2 undergoes terminal glycosylation and that chloroquine at anti-SARS-CoV concentrations (1-10 µM) abrogates the process.[51]

Glycosyaltion refers to the attachment of sugar units/chains to a protein (like ACE2).

Previous studies of chloroquine have demonstrated that it has multiple effects on mammalian cells in addition to the elevation of endosomal pH, including the prevention of terminal glycosyaltion of immunoglobulins.[51]

Other mechanisms of action of chloroquine (antimalarials) include:

(1) interference with lysosomal acidification and inhibition of proteolysis, chemotaxis, phagocytosis, and antigen presentation;
(2) decreasing macrophage-mediated cytokine production, especially interleukin-1 and interleukin-6;
(3) inhibition of phospholipase A2 and thereby antagonizing the effects of prostaglandins;
(4) absorption and blocking of UV light cutaneous reactions;
(5) binding and stabilizing DNA;
(6) inhibition of T and B-cell receptors calcium signaling;
(7) inhibition of matrix metalloproteinases, and
(8) the inhibition of toll-like receptor signaling.[53]

Pre-treatment of cells with chloroquine leads to under-glycosylated ACE2 on the cell's surface. The SARS-CoV spike protein binds poorly to under-glycosylated ACE2 preventing the virus from entering, i.e., infecting, cells. (Remember, that the SARS-CoV virus spike protein attaches to the ACE2 receptor, and uses it to gain entry to the cell.) It takes 20-24 hours for the under-glycosylated ACE2 to replace the fully-glycosylated ACE2. Any shorter period, and there may remain sufficient fully-glycosylated ACE2 to allow infection of the cell.

Pretreatment with 0.1, 1, and 10 µM chloroquine reduced infectivity (of SARS-CoV) by 28%, 53%, and 100%, respectively.[51]

At correct doses, etc, chloroquine is known to be relatively safe.

However, like Tylenol (also known as Paracetamol), and like vitamin A, chloroquine is toxic if administered in high doses. A derivate, hydroxychloroquine, has similar properties to chloroquine but has been determined to be safer.

The inhibitory effects observed on SARS-CoV infectivity and cell spread occurred in the presence of 1-10 µM chloroquine, which are plasma concentrations achievable during the prophylaxis and treatment of malaria (varying from 1.6-12.5 µM) and hence are well tolerated by patients.[51]

It is known that chloroquine is effective against various autoimmune diseases, and thus may be effective in the later stages of SARS-CoV infections.

In recent years, antimalarials (like chloroquine) were shown to have various immunomodulatory effects, and currently have an established role in the management of rheumatic diseases, such as systemic lupus erythematosus and rheumatoid arthritis, skin diseases, and in the treatment of chronic Q fever. Lately, additional metabolic, cardiovascular, antithrombotic, and antineoplastic effects of antimalarials were shown.[53]

Summary: Chloroquine showed incredible promise against SARS-CoV.

With chloroquine showing such promise, the pharmaceutical industry felt it important to discourage further research. Thus, they published this paper [54] that concludes, incorrectly, that while chloroquine is active against SARS-CoV, in vitro, it is not active, in vivo, and therefore no further research, or trials, need be done.

In the study we find that chloroquine was delivered to BALB/c mice for 3 days, beginning 4 hours prior to virus exposure. It was observed that this did not inhibit the spread of the virus. From this it was concluded that chloroquine is inactive, against SARS-CoV, in vivo. This conclusion is clearly unwarranted as the authors gave only 4 hours, rather than the stated 20-24 hours, for the replacement of fully-glycosylated ACE2 by under-glycosylated ACE2 on the cell surface. Thus, enough fully-glycosylated ACE2 receptors remained to allow infection by SARS-CoV. This "oversight" is evidence that this paper is a hit-piece against chloroquine. Another telling sentence is;

The chloroquines, of which amodiaquin is a derivative, also inhibited virus replication at similar concentrations, although all were much more toxic than has been previously reported.[54]

Without any supporting evidence the authors claim that chloroquine (and the chloroquines) are much more toxic than previously reported. By the way, the previously reported levels, 1-10 µM, are extremely safe, and dosages of 100 times this amount are regularly given to sufferers of rheumatoid arthritis, and lupus. The sentence in question is simply a bald-faced lie, hence its vagueness. Here are some further quotes;

Patients with autoimmune diseases are given 250 mg/day of chloroquine (400 mg/day of hydroxychloroquine) regardless of height or weight of the patient. That is, cumulative doses greater than 100 times that used for prophylaxis or treatment of malaria.[55]

Chloroquine has been widely used to treat human diseases, such as malaria, amoebiosis, HIV, and autoimmune diseases, without significant detrimental side effects.[51]

The authors also bizarrely claim that chloroquine is active in vitro, and is also not active in vitro;

Chloroquine has already been approved for therapeutic use for several diseases. Because other groups had shown in vitro efficacy, it warranted further evaluation in the mouse SARS-CoV replication model even though in the present study the material was not found to be active in vitro (Table 1).[54]

Amodiaquin, a derivative of chloroquine was a rather potent inhibitor of SARS-CoV replication in cell culture in the present study (Table 1) and was evaluated in parallel studies with chloroquine.[54]

Looking at Table 1 we find;

Chloroquine IC50 = 2.5 ±0.7 µM
Amodiaquin IC50 = 2.5 ±0.7 µM

What does chloroquine having an IC50 value of 2.5 ±0.7 µM mean? It means that chloroquine at a concentration of 2.5 µM inhibits the replication of the virus by 50%. That is, chloroquine is active, in vitro. What does chloroquine having the same IC50 value as amodiaquin, mean? It means that chloroquine, as well as amodiaquin, is a potent inhibitor of SARS-CoV replication, in vitro. It is amazing that the authors are able to contradict themselves within the same paragraph. Further evidence that this is a hit-piece, is that this paper goes on to be widely quoted as proof that chloroquine is not active against SARS-CoV, in vivo, yet not one of those quoting the paper notice it's obvious flaws.

How has this paper effected Covid-19 research?

Note that the Covid-19 virus is called SARS-CoV-2 because it is very similar to SARS-CoV (76% amino acid identity). The main differences being the added furin cleavage site, and the changed RBD (receptor binding domain). Both changes make the virus more contagious to humans. Although more contagious, SARS-CoV-2 is less dangerous. SARS-CoV is now often called SARS-CoV-1.

ACE2 is also the receptor used by SARS-CoV-2 (the Covid-19 virus) to infect cells. It is known that fully-glycosylated ACE2 is a very good fit to the SARS-CoV-2 receptor binding domain.[56] Thus, it is almost certain that ACE2 without terminal glycosylation will bind poorly, and chloroquine will be an effective prophylactic for Covid-19.

However, because of this hit-piece, any promise of chloroquine against SARS-CoV-2 that is shown, in vitro, will be accompanied by doubt about it, in vivo, and the necessary trials will likely not be done. As it turns out, chloroquine did show great promise against SARS-CoV-2, in vitro, and numerous clinical trials were initiated around the world. However, the pharmaceutical industry managed to halt most of these trials. For example, in order to bad-mouth chloroquine, the Brazilian Borba trial [57] gave near fatal doses of chloroquine to very sick patients. This had the desired effect of killing some of them, and making chloroquine appear quite dangerous. Criminal charges [58] were bought against the trial administrators.

Chloroquine and HIV/AIDS.

By 1987 researchers had found that chloroquine was active against HIV, and it appeared likely that chloroquine would eventually replace the very expensive, very toxic, drug AZT (azidothymidine, also known as zidovudine and retrovir) used in the treatment of AIDS, from which Burroughs Wellcome (GlaxoSmith-Kline) was making a killing. At US$10,000 a year for AZT the drug company stood to lose a very profitable product.

Some introductory remarks about HIV.

During the production of new viral particles HIV causes the cellular machinery to produce (among other things) the molecule gp160. This is then cleaved (at a furin cleavage site) by cellular proteases (enzymes which cut proteins) of the furin family, to produce gp120 (which contains the receptor binding domain of the HIV virus) and gp41 (which is the HIV fusion protein). These two remain associated through non-covalent interactions, and end up, as a unit called the gp120-gp41 complex, embedded in the viral membrane. The gp120 molecule sits in the fluid surrounding the virus loosely attached to one end of the gp41 molecule, the other end of which is embedded in the viral membrane. The gp120-gp41 complex is functionally equivalent to the covid virus spike protein. See [1] and [2]. The notation gp160 indicates a glycoprotein (a protein with multiple sugar units/chains attached to it) with a molecular weight of about 160 kilodaltons. Similarly, for gp120 & gp41.

To reproduce the HIV virus needs to get into a cell and use the cell's chemical machinery. To do this the gp120 part of the gp120-gp41 complex binds to a particular molecule, called CD4, found embedded in the membrane (surface) of certain human immune cells. Once bound, a complex series of changes, which involves the shedding (release) of gp120, enables the gp41 part of the complex to harpoon the cell membrane, pull the viral and cell membranes together, and fuse them. This has the effect of emptying the viral RNA into the cell cytoplasm where it hijacks the cellular machinery to produce more virus.

"Like all other viruses, HIV cannot reproduce on its own, requiring the reproductive apparatus of a cell that the virion “infects.” HIV gains entrance to a target cell mainly through a glycoprotein (gp120) of the viral envelope protein. Since HIV is a retrovirus (re = reverse, tr = transcriptase), it contains the viral enzyme RNA-dependent DNA polymerase (reverse transcriptase) that transcribes DNA from the virion's two identical strands of RNA containing all of virion's genetic information. The double-stranded DNA made by the virion's reverse transcriptase migrates into the nucleus of a target cell and is inserted with the aid of another viral enzyme (integrase) into the cell's genome. Once the virion's DNA is integrated into the cell's reproductive apparatus, exact copies of the virus are produced when the infected cell is stimulated to replicate. The proviral DNA is transcribed into viral RNA, and messenger RNA (mRNA) and new virions are synthesized which can infect new cells. Since zidovudine inhibits the HIV reverse transcriptase enzyme and stops proviral DNA chain synthesis in vitro, the drug held out promise of being effective in slowing or stopping the progression of the infection in vivo."[3]

In AIDS, the HIV virus (variously designated LAV, HTLV-III, or ARV) debilitates the body's immunological defenses, by infecting and killing CD4+ lymphocytes (CD4 expressing lymphocytes) and shedding immuno-suppressive gp120 from infected cells. CD4 lymphocytes defend against invading foreign matter; thus, their destruction renders the body susceptible to a spectrum of diseases. In addition to infecting CD4 lymphocytes, HIV also infects other immune system tissue such as monocytes, nervous system tissue, intestinal tissue and some bone marrow cells. Monocytes and macrophages (matured monocytes) are not killed outright by HIV. Rather, it is believed that, once infected, these cells serve to continuously incubate the virus.

The historical record.

In Nov. 1986, Maddon et al., published the paper [4] where they observed that; "If JM cells are exposed to ammonium chloride (for 6 hr) either at the time of addition of (the HIV) virus or within 30 min after the addition of virus, we observe greater than 95% inhibition of viral infection."

This paper was big news among AIDS researchers as it finally established that the HIV cellular receptor is CD4 (once called T4). Everyone in the field would have known of this paper. The paper also reported that ammonium chloride (NH4Cl) inhibited infection by more than 95%. Yet, somehow, this equally important result never made the headlines.

Maddon, and his team, explain that; "Previous studies have described two distinct pathways of entry for enveloped viruses. Some viruses fuse directly with the plasma membrane, releasing their nucleocapsids into the cytoplasm, whereas others are internalized by receptor-mediated endocytosis. The acidic environment of the endosome then facilitates fusion of the viral envelope with the limiting membrane of the vacuole. Infection by viruses that enter cells via the endocytic pathway can be inhibited by treating cells with agents such as weak bases which deacidify the endosome (Helenius et al., 1980,...)."

Checking the references (at the end of their paper) one finds that chloroquine, tributylamine, amantadine, methylamine and ammonium chloride (NH4Cl) are among the weak bases referred to. The reference [5] (Helenius et al.) presents the following table from which one can conclude that chloroquine is the most effective of these agents when dealing with the Semliki Forest Virus and thus potentially the most effective against HIV. They state: "For further studies, we used chloroquine as it was the most effective inhibitor."

Table 1: Effect of Lysosomotropic Agents on SFV Infection

Inhibitor PFU/ml Cells
Inhibitor concentration x 10-6 infected
mM
None - 140.0 64
Tributylamine 1.0 66.0 31
Amantadine 0.5 14.0 19
Methylamine 10.0 3.6 10
Chloroquine 0.1 1.2 <1
NH4Cl 10.0 0.8 <1

Given this, why did Maddon not report results for chloroquine. Given that chloroquine would have been expected to be the most effective against AIDS, even a negative result would have been of interest. We now know, for example, that 12.5 μM/L chloroquine inhibits HIV infection by 90%. Maddon, and team, would have certainly investigated chloroquine and thus could have reported that chloroquine, at the clinically achievable concentration of 12.5 μM/L, inhibited HIV infection by 90%, but they chose to report that ammonium chloride, at the very toxic concentration of 20,000 μM/L, inhibits HIV infection.

So, as you can see, the conspiracy against chloroquine was already up, and running, in 1986.

Another reason Maddon, and team, should have reported on the effect of chloroquine, is that, five months before their paper, Thorens, and Vassalli, had reported that both chloroquine, and ammonium chloride, prevented the terminal glycosylation of immunoglobulins (and thus chloroquine, as well as ammonium chloride, should inhibit HIV infection by preventing the glycosylation of the gp120-gp41 complex).[6]

In Feb. 1987, Bruce Kagan wrote a letter to the editor of The Western Journal of Medicine, pointing out the potential of chloroquine to combat HIV.[7] Although published four months after Maddon et al's article appeared (in the journal Cell) Kagan only references a research announcement to Maddon's work (in the journal Science) that did not report the fact that ammonium chloride greatly inhibits HIV infection. Adding this fact would have significantly strengthened Kagan's case. Importantly, Kagan notes that, even if the concentration of chloroquine needed in vitro may have been severely toxic, chloroquine becomes highly concentrated in certain tissues in vivo, notably in the cerebrospinal fluid (10 to 30 times plasma level), the reticuloendothelial system (6,000 times), and leukocytes (100 to 200 times), meaning that in certain situations the use of very high concentrations of chloroquine in vitro is justified, as the concentration in vivo (in the plasma) remains safe.

From 1986 to 1995 the conspirators dissuaded all from conducting the clinical trials called for by Kagan.

Maddon, and team, further say; "These results (the inhibition of viral infection) are consistent with a mechanism of viral entry which involves endocytosis of the CD4-AIDS virus complex and low pH-induced fusion of the viral envelope with the limiting membrane of the endosome, releasing the viral nucleocapsid into the cytoplasm of the cell. It should be noted, however, that ammonium chloride and amantadine may exert other inhibitory effects on virus production and additional experiments are required before we may conclude with certainty that the primary route of entry of the AIDS virus is via receptor-mediated endocytosis."

Later, the speculation that HIV enters cells via receptor-mediated endocytosis was proved false. Rather, it was found that ammonium chloride caused the viral progeny to be non-infectious. This was verified in another paper which also avoids reporting on chloroquine. We find that; "Maddon et al. (1986), however, suggested (reported) that NH4Cl inhibits HIV-1 replication. A possible explanation for this discrepancy is our finding that weak bases inhibit the release of infectious HIV-1," and "Our experiments indicate that the budding and release of HIV-1 virions is not itself affected by NH4Cl treatment, because there is no significant reduction of particles containing RT (reverse transcriptase), but that the virions released in the presence of NH4Cl have reduced infectivity."[8]

What we learn is that chloroquine does not stop the entry of (fully functional) HIV into cells. What chloroquine does is it causes the production of non-functional viral offspring which are non-infectious, i.e., incapable of infecting further cells. Chloroquine does not directly reduce the number of new virions produced. It reduces the number of functional virions produced, which reduces the number of newly infected cells. So, chloroquine indirectly inhibits viral entry into cells and thus inhibits replication of the virus.

In another paper, which also strangely avoids reporting on chloroquine, we find that; "An unexpected result from our studies was the marked sensitivity of gp160 cleavage to NH4Cl. A recent report [8] has shown that NH4Cl treatment of HIV-1-producing T cell and monocyte cell lines results in a major loss (>95%) in titer of infectious virions. Coupled with our findings, these results suggest that, in the presence of NH4Cl, noninfectious nucleocapsids that lack gp120 are released into the medium and point to the intracellular cleavage of gp160 as a requirement for infectivity."[9]

Actually, they did mention chloroquine, but tell you nothing; "Partial inhibition was also observed with the weak base chloroquine (data not shown)."

As mentioned above gp160 is cleaved to produce gp120 and gp41. These last two remain non-covalently associated, and are added, as a unit, to HIV virions during assembly. Some say that uncleaved gp160 is directed to a lysosome and broken down, others, that it is added to virions, or perhaps both occur. Whatever the case, virions produced in the presence of NH4Cl are non-infectious.

So, what was the response of the scientific community to the news that various weak bases inhibited HIV infection by greater than 95%. Did they yell from the roof-tops that a cure for AIDS may be at hand? Did hundreds of scientists enter the area to confirm, and extend. Did they immediately set up clinical trials to check that in vitro results held in vivo? No, they did none of that, however they did hurry out an entire issue of Scientific American (October 1988) singing praises of the very toxic drug AZT, and other retroviral drugs pushed by the pharmaceutical companies, without ever mentioning NH4Cl, or chloroquine, or any of the other aforementioned weak bases.[10]

Papers claiming that chloroquine is effective against HIV were published in the 5th International Conference on AIDS in June 1989.[11] Here are the abstracts of two;

Abstract: "The effect of chloroquine, an anti-malarial drug known to affect cellular exocytic pathways, was studied in two retroviral systems: human immunodeficiency virus (HIV-1) and avian reticuloendotheliosis virus (REVA). With chloroquine treatment of virus infected cells, significant size reduction of the cell and virus associated surface glycoproteins, gp90 of REV-A and gp120 of HIV-1, was observed. In the case of HIV-1, extracellular virions derived from treated cells contained very little gp120. Infectivity and reverse transcriptase assays carried out with HIV-1 demonstrated that by chloroquine treatment virus yield was reduced and noninfectious virions were released. The data suggests that inhibition by chloroquine is most likely due to interference with terminal glycosylation in the trans-Golgi network. Studies are in progress to determine the effect of chloroquine on HIV-1 and its relatives produced by other cell types e.g. monocytes/macrophages and to evaluate whether chloroquine and its existing analogs or newly synthesized related weak bases could be useful either alone or in combination with other drugs to attack various stages of the virus life cycle."[12]

It is interesting that chloroquine showed great promise against both HIV and REV-A, and that studies were in progress to extend the reported observations. None of these studies were ever published, in fact, the sentence "Studies are in progress...." was dropped from the journal version of the article.[13]

Abstract: "The treatment of HIV infected monocytes by chloroquine resulted in the formation of intracellular vacuoles containing virions in various stages of degredation similar to those observed in SFV (Semliki Forest Virus) infected cells treated with lysosomotropic agents (1) and in HSV (Herpes Simplex Virus) infected cells expressing a glycoprotein that interferes with the fusion reaction of virion envelope with the cell-membrane (2). By contrast such intravacuolar accumulations of virions were not observed in HIV infected monocytes not treated by the drug."[14]

This study was never published in a journal so it would be of great interest to find notes from the talk. Once again chloroquine is reported to show great promise against HIV. In this case against the infection of monocytes. Any action against the infection of monocytes is of particular interest as drugs like AZT and DDC are essentially useless in this regard. The reason for this is:

"Before a nucleoside analogue (like AZT and DDC) can be incorporated into a strand of nucleic acid it must be phosphoryiated by a kinase (converted to a nucleotide). T-cells which are capable of rapid division possess high levels of kinases to phosphorylate antiviral drugs like AZT and DDC. Monocytes which divide only under special circumstances, possess relatively low levels of the requisite kinases and the nucleoside derivatives do not protect them against infection. The simple solution would be to administer the phosphoryiated form of the nucleotide analogues. These, however, are not transported across cell membranes. Thus the current nucleoside analogue therapy is ineffective in protecting monocytes from HIV infection."[15]

In 1993, Sperber et al reported that: "Hydroxychloroquine inhibited HIV-1 replication (>75%), as measured by reverse transcriptase activity, in the primary T cells and monocytes as well as the T cell (CEM) and monocytic cell lines (U-937). Hydroxychloroquine itself had no anti-reverse transcriptase activity and was not toxic to the cells at concentrations inhibitory to viral replication."[16]

Although Sperber et al claim a greater than 75% inhibition of replication in the paper's abstract, there is no further reference to this claim in the paper. Examining the graphs in figures 1 & 3 we find that 100 μM/L hydroxychloroquine inhibits reverse transcriptase activity by 68% in primary T cells, by almost 75% in primary monocytes, by 30% in CEM cell lines and by 81% in U-937 cell lines.

Reverse transcriptase activity measures the overall viral yield. Thus it measures both infectious and non-infectious virus. The fact that less than one in 10,000 HIV virions are infectious[17] means that the inhibition of replication is less than the inhibition of infectivity. Thus the inhibition of infectivity is a much better choice (than the chosen reverse transcriptase activity) with which to measure the effectiveness of hydroxychloroquine. From Tsai, et al, (one of their references) we read;

"From our studies, chloroquine appeared to be an effective inhibitor of HIV-1 by reducing both the yield (measured by reverse transcriptase assay) and infectivity (measured by a microtiter syncytial-forming assay with cloned CEM cells) of the virus produced in chronically infected cells. This effect of chloroquine is consistent with the reported inhibition of HIV infectivity by NH4Cl." and "The reduced RT (reverse transcriptase) activity is likely due to the decrease in the number of virions produced. However, the extent of reduction of RT was apparently less than that of infectivity (see Table 1)."[13]

We fit the relevant curves to Tsai et al's data to obtain the following graph;

Image

For chloroquine (as can be seen from the graph) the inhibition of replication is much less than the inhibition of infectivity. Since chloroquine and hydroxychloroquine are chemically similar, and are acting as lysosomotropic agents, one expects this to also be true for hydroxychloroquine. In a short paragraph (split over 3 pages) at the end of their paper, Sperber et al do actually measure the inhibition of infectivity. They report that the production of infectious virus was inhibited by 77% in CEM cells, and 80% in U-937 cells. They do not report the concentration of hydroxychloroquine used, but we infer that there is a concentration where the inhibition is as stated. So, there you have it. Sperber et al measured the inhibition of infectivity, and also the inhibition of replication, and then choose the method that gave the worst results. Yes, looks like this is yet another paper written in aid of the war against cheap drugs.

And then, there are the lies of omission. They say, not a word, about chronically infected cell lines. Why is this? Given how important the topic was in AIDS research it is a rather glaring omission. The reason is simple, AZT has little, or no effect, on the production of infectious virus by chronically infected cells, whereas, hydroxychloroquine is effective against such. One must never be told that hydroxychloroquine is a much better drug than AZT.

"Zidovudine (AZT) and similar RT inhibitors have little or no effect on the production of infectious virions by chronically infected cells."[18]

That Sperber et al are funded by Sanofi-Winthrop Pharmaceuticals, comes as no surprise.

Early on, the most up to date research seems to be not in scientific papers, but in patent applications. See [16] for what was known before Feb. 1988. A patent was filed on 14 September 1990, by Ellen Vitetta, and & Jonathan Uhr, for the Board of Regents of The University of Texas System. It states;

"It has been found by the inventors that chloroquine alone exhibits significant anticellular activity against HIV-infected cells. Furthermore, chloroquine will act in concert with the toxin conjugates of the present invention to improve their anti-HIV efficacy. In both instances, it is suggested or has been found that the amount of chloroquine to be administered to a patient in need of such therapy will be similar to that amount normally administered for other indications of chloroquine, such as in the treatment of malaria."[19]

Another patent [15 May 1991], by the same pair, was filed in May 1991 which claimed that chloroquine selectively killed HIV-infected cells [NIH grant AI-27336]. This should have been big news.

Abstract: "The present disclosure demonstrates the use of chloroquine to selectively kill HIV-infected cells. The invention involves, in part, the use of chloroquine in treatment regimens for the treatment of HIV-infected individuals, wherein chloroquine is administered to such individuals in pharmacologically effective doses. While it is proposed that chloroquine may be administered to HIV-infected individuals alone, it is believed that additional benefits may be realized through the administration of chloroquine in combination with other agents such as anti-HIV immunotoxins (e.g., CD4-based immunotoxins, or anti-gp4I or anti-gp120-based immunotoxins). In these embodiments, it is believed that chloroquine will act synergistically with the anti-HIV immunotoxins to effect a selective killing of HIV-infected cells."[20]

If, as reported in the patent, chloroquine selectively kills HIV in vitro this makes it "orders of magnitude" better than AZT. Also, due to the nature of the action of weak bases like chloroquine, this is likely true in vivo. As far as I am aware, the fact that chloroquine selectively kills HIV in vitro never makes it into the scientific journals. Not even as an experiment to investigate the possibility. The patent also states;

"In in vitro IC50 tests, HIV-infected human H9 T-cells have been found by the inventors to be up to fifty-fold more sensitive to chloroquine than uninfected cells. Studies also indicate that the concentrations necessary to kill infected cells in vitro are within the dosage range used for in vivo treatments of other diseases such as malaria." and "Chloroquine's quality of specifically concentrating in the very tissues likely to be infected by HIV means that chloroquine can be delivered to these tissues in an appropriate dosage while exposing the tissues unsusceptible to infection to a relatively low dosage. This quality of chloroquine should minimize the potential for adverse reactions in the unsusceptible tissues."

At the end of 1986 it was clear that clinical trials testing chloroquine (as requested by Bruce Kagan) needed to be done. Yet for nearly a decade no trial was done, In 1995 a small 8 week long clinical trial is finally done.

"In 1995, Sperber et al conducted a randomized, double-blinded, placebo-controlled study of 40 asymptomatic HIV-positive patients with CD4 counts between 200 and 500 cells/mm3. Half of the patients received HCQ, the other half served as controls. The placebo group showed an increase in viral RNA load (bad), no change in IL-6 levels, and a decline in both the CD4 percentage (bad) and T-cell proliferation to Candida (bad). In contrast, the HCQ-treated group experienced a decline in HIV-1 RNA (good) and IL-6 (good), and maintained CD4 percentages (good) and mitogen and antigen-specific T-cell proliferative responses (good)."[21]

This clinical trial was written up as "Hydroxychloroquine treatment of patients with Human Immunodeficiency Virus Type 1."[22] Is this another paper written to mislead? Looks like it. Here we have a clinical trial done at the Mount Sinai Medical Center in New York City, an epicenter of the AIDS crisis, with thousands, and thousands, of patients who would have been willing to participate in an eight week trial to test hydroxychloroquine. Yet only 42 participate. Clearly, the decision to proceed with an under-powered clinical trial must have been deliberate.

"Sperber extended his study by comparing HCQ to zidovudine (AZT) in the same group of patients (as in the 1995 clinical trial). There was no statistical difference in the magnitude of RNA viral load decline, levels of cultured virus, p24 antigen, or CD4 counts. IL-6 and serum IgG levels were significantly reduced (good) in the HCQ group, but not the zidovudine group."[21]

The extended study appeared in 1996 as "Inhibition of HIV-1 replication by Hydroxychloroquine: Mechanism of action and comparison with Zidovudine (AZT),"[23] This is yet another paper in the war against cheap drugs. Here are some quotes from the paper;

"The effective concentration of HCQ to reduce viral replication by 50% (ED50) was 0.01 mmol/L (10 μM/L) in the 63-cells and 0.1 mmol/L (100 μM/L) in the SP cells." and "Both HCQ and AZT (ZDV) had anti-HIV-1 activity in the pretreated, recently infected SP and 63 cells (Figure 4), although HCQ was less effective. The ED50 for AZT (ZDV) was 0.001 mmol/L (1 μM/L), while the ED50 for HCQ was 0.01 mmol/L (10 μM/L)."[23]

A quick look at Figure 4 tells you that some of the ED50 numbers must be wrong. In the hope that the graphs are less in error than the text, I have calculated the ED50 numbers from them. (One fits the data to a graph of the form y=100/(1+(a/x)^b) by least squares, which determines a = ED50 and b = the Hill coefficient.) I have made the assumption that ED50 = IC50, i.e., that the drugs completely inhibit the relevant biological activity at high dose. This gives somewhat different results:

ED50[AZT; newly infected 63 cells] = 0.3 μM/L (inferred to be 1 μM/L).
ED50[HCQ; newly infected 63 cells] = 0.4 μM/L (said to be 10 μM/L).
ED50[AZT; newly infected SP cells] = 0.1 μM/L (inferred to be 1 μM/L).
ED50[HCQ; newly infected SP cells] = 49.0 μM/L (said to be 100 μM/L).
ED50[HCQ; chronically infected 63HIV cells] = 9.1 μM/L (not stated).
ED50[AZT; chronically infected 63HIV cells] is undefined, as AZT has no effect at all.
ED50[HCQ; chronically infected SPH cells] = 39.0 μM/L (not stated).
ED50[AZT; chronically infected SPH cells] is undefined, as AZT has no effect at all.

"Either AZT or HCQ was maintained in culture at a concentration of 1 μmol/mL (1000 μM/L)."[23] One assumes that this is an error.

Note that cells were harvested daily for 14 days to further! assess the toxicity of HCQ. However, no such experiment was done to access the toxicity of AZT.

"We next compared the anti-HIV-1 effect of HCQ with zidovudine (AZT) in both newly and chronically HIV-1-infected T-cell and monocytic cell lines (63 and 63HIV). HCQ suppressed HIV-1 replication in a dose-dependent manner in both recently and chronically infected T-cell and monocytic cell lines. In contrast, zidovudine (AZT) pretreatment had potent anti-HIV-1 activity in the newly infected T and monocytic cells but not in chronically infected cells."[23]

The above is very deceptively worded. Let's add some details (in square brackets):

"We next compared the anti-HIV-1 effect of HCQ with zidovudine (AZT) in both newly and chronically HIV-1-infected T-cell [lines; i.e., SP and SPH cells] and monocytic cell lines (63 and 63HIV). HCQ suppressed HIV-1 replication in a dose-dependent manner in both recently and chronically infected T-cell [lines; SP cells; ED50 = 49 μM/L and SPH cells; ED50 = 39.0 μM/L] and monocytic cell lines [63 cells; ED50 = 0.4 μM/L and 63HIV cells; ED50 = 9.1 μM/L]. In contrast, zidovudine (AZT) pretreatment had potent anti-HIV-1 activity in the newly infected T [cells; SP cells; ED50 = 0.1 μM/L] and monocytic cells [63 cells; ED50 = 0.3 μM/L] but not in chronically infected cells [where AZT has zero effect on SPH cells and zero effect on 63HIV cells]."

Stating that AZT pretreatment had potent anti-HIV-1 activity in the newly infected T and monocytic cells but not in chronically infected cells, suggests that AZT has some value for chronically infected cells. However, AZT has no anti-HIV-1 activity, at all, in chronically infected cells.

"AZT has no effect on virus replication of an already integrated virus."[24]

"Although AZT prevented acute HIV infection of susceptible cells, it did not prevent the induction of HIV expression in the infected cell lines."[25]

"Compounds currently used for AIDS therapy, such as AZT, DDL and other nucleoside analogues, are inhibitory to HIV infection of T cells in vitro at low concentrations. They are, however, ineffective as anti-HIV agents when the virus is already integrated into the T-cell DNA, so that the cells are chronically or latently infected."[26]

Let's find out a little more about AZT.

"Current AIDS therapy which is directed towards protecting uninfected cells, consists of oral dosing about every four hours with nucleoside analogues (such as AZT and DDC) which inhibit viral RNA replication. Although these drugs inhibit viral replication at concentrations of 50-500 μM, at higher concentrations (~1000 μM) they also inhibit the DNA polymerase of healthy cells which is required for cell division. The current therapy requires very large doses of drugs (up to a gram/day). Because the drugs are taken orally and in a form that is absorbed by all cells, the entire body is exposed to them. Toxicity is a serious limitation to their use; anemia being one of the most severe side effects. Because nucleoside derivatives must be phosphoryiated before they can be incorporated into DNA (and express their chain disrupting activity) they require kinases which are not present in equal amounts in all cells susceptible to viral infection. Thus the oral nucleoside analogue therapy, which is ineffective against already infected cells, is only able to protect those susceptible cells which can convert high concentrations of nucleosides into nucleotides (i.e., dividing cells). For these reasons this therapy is limited and the progression of the disease is only slowed."[15]

Although very toxic in the quantities administered, AZT did show promise of being effective in slowing or stopping the progression of the infection in vivo. However as early as 1987 it was known that AZT only inhibits viral replication for a short period.

"Initially AZT works to inhibit the virus but after a period AZT treated cells produce as much virus as non-treated cells."[27]

"Probably, a majority of the DNA copies initiated by RT in newly infected cells are prematurely terminated, but if at least one complete copy is made (it only takes one), a cell may go on to produce progeny virus. Whether virus spread occurs by cell-free virus or by cell-to-cell contact, (even) cultures treated with 25 μM AZT (the highest dose tested) eventually produced as much virus as the non-drug-treated infected cultures. These results were confirmed by the detection of unintegrated viral DNA in drug-treated H9 cultures when they began producing virus at high levels. The unintegrated viral DNA in these drug-treated cultures was present in quantities similar to those in non-drug-treated infected cultures."[27]

"The inability of zidovudine (AZT) therapy to prevent infection after exposure to HIV is described in a report by Lange et al. In a tragic hospital accident, a seronegative 58-year-old heterosexual man was injected with HIV-contaminated blood. This mistake was realized within minutes of its occurrence, and within 45 minutes after exposure to HIV-1, massive zidovudine therapy was begun. In spite of the daily administration of large amounts of zidovudine (AZT), the patient seroconverted (started producing antibodies against HIV as a result of the HIV infection becoming established) on the 41st day after exposure. These results suggest that the HIV-1 infection could be established by cell-to-cell transmission of the virus or that zidovudine may not completely inhibit reverse transcription. The latter explanation could account for the limited ability of zidovudine therapy to stop HIV replication in vivo and extend the survivability of HIV infecteds with bureaucratic AIDS."[27]

It is important to note that AZT only inhibits replication. It does not, and cannot kill HIV. It's mode of action makes it clear that AZT cannot kill the virus.

In his book "Poison By Prescription. The AZT story," John Lauritsen states:

"In my articles (in this book) I have analyzed the studies that allegedly demonstrate AZT's effectiveness, and have concluded that there is no scientifically credible evidence that AZT has benefits of any kind. Documents which the Food and Drug Administration (FDA) was forced to release under the Freedom of Information Act revealed that the Phase II ("double-blind, placebo-controlled") AZT trials were worthless. The researchers covered up the fact that the study had become unblinded (thus violating the basic test design). Protocol violations were overlooked. Worst of all, the researchers deliberately used data that they knew were false. These fraudulent trials were the basis of government approval of the drug. Another study often cited as proof of AZT's benefits concerns patients who received AZT after the Phase II trials were prematurely terminated. I have written an extensive analysis of this study, which is a rotten mixture of incompetence and dishonesty. Through colossal incompetence the researchers lost track of 1120 patients, not knowing if they were even alive or dead. They then used statistical projection methods to guess what results they would have obtained if they had not lost the 1120 patients, presented their guesses as actual survival statistics, and made a number of grossly invalid comparisons in order to claim that AZT had extended lives. This "research" is a blatant exercise in disinformation, proving nothing except how farcical are the "peer review" standards of medical journals."[28]

A very similar article could be written about the Covid scam.

"AZT is the only antiretroviral drug that has received FDA approval for treatment of AIDS since the epidemic began ten years ago, and the decision to approve it was based on a single study that has long been declared invalid. The study was intended to be a “double-blind placebo-controlled study.” In such a study, neither patient nor doctor is supposed to know if the patient is getting the drug or a placebo. In the case of AZT, the study became unblinded on all sides, after just a few weeks. Both sides contributed to the unblinding. It became obvious to doctors who was getting what because AZT causes such severe side effects that AIDS per se does not. Furthermore, a routine blood count (watching for cytomegalovirus infections), which clearly shows who is on the drug and who is not, wasn't whited out in the reports. Both of these facts were accepted and confirmed by both the FDA and Burroughs Wellcome, who conducted the study. Many of the patients who were in the trial admitted that they had analyzed their capsules to find out whether they were getting the drug. If they weren't, some bought the drug on the underground market. Also, the pills were supposed to be indistinguishable by taste, but they were not. Although this was corrected early on, the damage was already done. There were also reports that patients were pooling pills out of solidarity to each other. The study was so severely flawed that its conclusions must be considered, by the most basic scientific standards, unproven. The most serious problem with the original study, however, is that it was never completed. Seventeen weeks into the study, when more patients had died in the placebo group, the study was stopped, five months prematurely, for “ethical” reasons: It was considered unethical to keep giving people a placebo when the drug might keep them alive longer. Because the study was stopped short, and all subjects were put on AZT, (and any treatment without AZT falsely declared unethical) no scientific study can now be conducted to prove unequivocally whether AZT does prolong life."[29]

From this, it truly looks like the AIDS crisis was used as a model for the Covid scam.

How did the extremely toxic drug AZT become the standard of care in the AIDS crisis, while chloroquine and hydroxychloroquine were side-lined?

How did the extremely toxic drug Remdesivir become the standard of care in the Covid scam, while chloroquine and hydroxychloroquine were side-lined?


[1] The HIV-1 envelope glycoproteins: folding, function and vaccine design.
[2] HIV Infection: The Cellular Picture. Scientific American, October 1988.
[3] The Impact of Zidovudine (AZT) Therapy on the Survivability of Those with the Progressive HIV Infection.
[4] The T4 (CD4) gene encodes the AIDS virus receptor and is expressed in the immune system and the brain.
[5] On entry of Semliki forest virus into BHK-21 cells.
[6] Chloroquine and ammonium chloride prevent terminal glycosylation of immunoglobulins in plasma cells without affecting secretion.
[7] Lysosomotropic Agents in AIDS Treatment.
[8] Human immunodeficiency virus infection of CD4-bearing cells occurs by a pH-independent mechanism.
[9] Biosynthesis, cleavage, and degradation of the human immunodeficiency virus 1 envelope glycoprotein gp160.
[10] Scientific American, October 1988.
[11] Fifth International Conference on AIDS, Quebec, Canada June 4-9, 1989.
[12] Abstract. Session M.C.P.66. Inhibition of human immunodeficiency virus infectivity by chloroquine.
[13] Inhibition of Human Immunodeficiency Virus Infectivity by Chloroquine.
[14] Abstract. Session M.C.P.119. Effect of chloroquine on HIV-1 infection of monocytes.
[15] Methods and compositions for the use of hiv env polypeptides and antibodies thereto.
[16] Inhibition of Human Immunodeficiency Virus Type 1 replication by Hydroxychloroquine in T Cells and Monocytes.
[17] Factors underlying spontaneous inactivation and susceptibility to neutralization of Human Immunodeficiency Virus.
[18] Human immunodeficiency virus type 1 protease inhibitors irreversibly block infectivity of purified virions from chronically infected cells.
[19] Patent PCT/US90/05234. Therapeutic compositions; Methods for treatment of HIV infections.
[20] Patent PCT/US91/03383. Method for killing HIV-infected cells.
[21] Effect of chloroquine on human immunodeficiency virus (HIV) vertical transmission.
[22] Hydroxychloroquine treatment of patients with Human Immunodeficiency Virus Type 1.
[23] Inhibition of HIV-1 replication by hydroxychloroquine: Mechanism of action and comparison with zidovudine.
[24] Inhibition of Replication and Cytopathic Effect of Human T Cell Lymphotropic Virus Type III.... Virus by 3'-Azido-3'-Deoxythymidine In Vitro.
[25] Interferon-α but not AZT suppresses HIV expression in chronically infected cell lines.
[26] Inhibition of the production of HIV-1 from chronically infected H9 cells by metal compounds and their complexes with L-cysteine or N-acetyl-L-cysteine.
[27] Resumption of virus production after Human Immunodeficiency Virus infection of T lymphocytes in the presence of azidothymidine.
[28] Poison By Prescription; The AZT story (1990), by John Lauritsen.
[29] AIDS and the AZT Scandal: SPIN's 1989 Feature, Sins of Omission.

Pfizer's own trial shows it's vaccine increases sickness, and death.

Pfizer's own clinical trial (43,548 participants) has shown that their "vaccine" increases sickness, and death, relative to those in the placebo group. This shows that the Pfizer "vaccine" should have never received emergency use authorization, and that the Pfizer people are a bunch of criminals. This video discuses the trial. 50 MB. Here is an email sized version. 25 MB. There is a PDF that accompanies the video here. The "Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine through 6 Months" article & appendix are here and here. Pfizer's post-marketing pharmacovigilance report mentioned on page 30 of accompanying pdf can be found here. This paper [48] from "Toxicology Reports" looks at the short-comings of the Pfizer trials, and asks the question "Why are we vaccinating children against Covid-19?"

Fuct-checkers have claimed that the animal tests were not skipped as said in the video. However, the animal tests were skipped, and Pfizer proceeded to the human trials without them. The human clinical trials began April 29, 2020, and the animal test results were published on Sept 8, 2020. Animal tests are done to ensure the safety of those in the human trials. That is why animal tests are always conducted before the human clinical trials. That the animal tests were done later made them almost irrelevant.

Some very important developments.

Fully-vaccinated infected at twice the rate of the un-vaccinated.

Statistics from the UKHSA (United Kingdom Health Security Agency) tell us that the fully-vaccinated are being infected at (more than) twice the rate of the un-vaccinated. This has been reported to be the case in every NHS "Covid-19 vaccine surveillance report" since early September 2021. The relevant statistics are reported weekly, and cover the proceeding month.

For example, in the Covid-19 vaccine surveillance report – week 44 (Oct. 4 to 31, 2021) data supporting this conclusion can be found in Table 5 on page 20. The table is titled; "Unadjusted rates of Covid-19 infection, hospitalisation and death in vaccinated and unvaccinated populations." The first few columns of Table 5 are;

Age  Cases of Covid-19   Cases of Covid-19
per 100,000 of the per 100,000 of the
fully-vaccinated un-vaccinated

<18 346 2,891
18-29 614 710
30-39 1,221 893
40-49 2,125 933
50-59 1,409 656
60-69 999 460
70-79 741 373
≥80 480 375

Let me spell out what these numbers are saying;

If you are fully-vaccinated, and between 40 and 80 years old, you are about twice as likely to catch covid-19 as the un-vaccinated.
If you are fully-vaccinated, and between 30 and 40 years old, you are 1.4 times as likely to catch covid-19 as the un-vaccinated.
If you are fully-vaccinated, and older than 80, you are about 1.3 times as likely to catch covid-19 as the un-vaccinated.


But, how can a fully-vaccinated individual be more than twice as likely to catch covid-19 as an un-vaccinated individual? Even if the vaccine didn't work, at all, you would only expect about the same number of covid-19 cases in both the vaccinated, and un-vaccinated. But, we see twice the number of covid-19 cases in the fully-vaccinated.

So, what is happening?

Well, this is vaccine dependent enhancement (also called antibody dependent enhancement or ADE). Vaccine dependent enhancement has been observed in all the previously produced vaccines against coronaviruses. This is why no coronavirus vaccine has ever been offered to the public, previous to Covid-19. This is the vaccine dependent enhancement that so many scientific papers, and experts in the field, warned vaccine makers to watch for. But while claiming to be the science, the evil nutters refused to listen to the science. The nutters produced vaccines, and never bothered to check for vaccine dependent enhancement.

But, how can the exact same covid-19 virus be much more infectious after vaccination, than it was before vaccination?

In vaccine dependent enhancement, some antibodies, produced in response to the vaccine, open up a new way for the Covid-19 virus to get into (i.e., infect) your cells. If this new route into your cells is more easily negotiated than the original route, then the virus will be more infectious. If the new route is twice as easy to negotiate, then the virus will be twice as infectious as it was. Even if the vaccine is 100% effective in stopping entry by the original route, you can still be twice as likely to catch the disease due to this alternate, antibody dependent, route into your cells.

It is apparent that the people running the UKHSA website have noticed these figures, and are taking steps to hide them. From week 47 on, the Covid-19 vaccine surveillance reports actually present the offending numbers in grey, so that they will be less noticeable. They also appear to be manipulating/falsifying the data in the age group ≥80. There does not appear to be any rational explanation for the changes occurring in this age group. If you have an explanation, please let me know.

You can find the weekly Covid-19 vaccine surveillance reports here.
The relevent pages from the week 44 report can be found here.

It appears that the vaccine manufacturers, and their owners, only care about taking your money. They did not even care enough about your health to check for vaccine dependent enhancement, which they had to know was likely to occur.

What is antibody-dependent enhancement?

When your body is alerted to a virus, it produces antibodies against it. These are large Y-shaped molecules that have variable regions in the tips of the arms of the Y. Different amino acid sequences in the tips, form different antibodies, that are able to bind to different regions/parts of the virus. Billions of copies of each of these distinct antibodies are created, and this mass of antibodies circulates in the body, with each looking for the piece of virus that it matches, and can bind to. On finding the requisite piece, it binds to it, tagging the virus, so that specialist cells can locate, and destroy, it.

One such specialist cell is the macrophage. These have a (surface) receptor, called an Fcγ-receptor, that attaches to antibodies that are attached to a virus. The tips of the antibody attach to the virus while the lower section of the antibody attaches to the Fcγ-receptor of the macrophage. Once attached, the macrophage engulfs the virus + antibody + Fcγ-receptor, i.e., the macrophage wraps the virus + antibody + Fcγ-receptor in a membrane, and brings it inside the cell, as a bubble, called an endosome. Hydrogen ions, and proteases (enzymes that cut up proteins) are pumped into the endosome, turning it into a acid bath where the virus is destroyed (i.e., broken down into harmless bits and pieces). Generally, this works, the virus is digested, and its bits, and pieces, recycled.

However, this cleanup process does not always work well for the covid virus. The reason being that the covid virus is able to escape endosomes, and infect the surrounding cell. When hydrogen ions, and proteases, are pumped into the endosome to digest the virus, the acidic environment enables a protease, called cathepsin-L, to prime the spikes of the virus. Now, if one of these primed spikes contacts the endosome membrane, it will harpoon the membrane, and merge both viral, and endosome membranes. This dumps the viral RNA into the cell cytoplasm, infecting the cell. For some reason the covid virus cannot productively reproduce in most macrophage cell types, however, in vulnerable individuals, its presence results in a cytokine storm. It is this cytokine storm that kills many people.

Whether or not this cleanup process works for the covid virus depends on how strongly the various antibodies cling to the virus. When enough antibodies cling to the spike proteins, and cling for a long enough time, their physical presence prevents cathepsin-L from priming the spikes, and even if a few spikes are primed, the antibodies attached to other spikes physically prevent them from approaching the endosome membrane, and infecting the surrounding cell. Antibodies that cling to the virus long enough to prevent infection of the surrounding cell, are called neutralizing antibodies.

However, there are also non-neutralizing antibodies. Some antibodies do not attach to the virus strongly, and can dissociate from it before it is disabled. If enough antibodies dissociate from the virus, cathepsin-L is able to prime some of the spikes, and some of these may then push up against the endosome membrane, merge with it, and infect the surrounding cell. Such antibodies are called non-neutralizing antibodies. Non-neutralizing antibodies are dangerous as they open up a new way for the covid-virus to infect your cells. This opening up of a new route of infection, is called antibody-dependent enhancement (of infection) or ADE.

It is worth noting that hydroxychloroquine prevents the acidification of endosomes, which prevents the action of cathepsin-L, and thus may prevent ADE in covid. However, in [45] it is shown that antibody dependent enhancement of SARS-CoV-1 infection occurs in the presence of cathepsin-L inhibitors. This implies another protease (present in the endosomes of macrophages, etc) can prime SARS-CoV-1. Since it is likely that this protease will also prime SARS-CoV-2, it is likely that hydroxychloroquine, by itself, will not prevent ADE in covid.

Here is a diagram from [44]. It illustrates two types of ADE. One being via the Fcγ-receptor (called FcR in the diagram), the other being via the C3b-receptor. Macrophages, monocytes, and dendritic cells have Fcγ-receptors. The Y-shaped molecules represent antibodies. They are labeled IgG. Ig stands for immunoglobulin (another name for an antibody). IgG is the most common variety of antibody. One of the pathways leading to covid-virus infection is illustrated on the left. The pathway via endosomes is strangely missing. The ACE2 (angiotensin-converting enzyme 2) receptor is represented by an orange oval. Outside the cell is brown, inside is green.

Image

Regarding the missing infection pathway, via endosomes, one has. The covid-virus infects a cell by first attaching to a particular cell receptor, called an ACE2-receptor. In the presence of certain proteases, the viral membrane merges directly with the cell membrane, and the viral RNA is dumped into the cell cytoplasm, infecting the cell. In the absence of these proteases, the virus + receptor is bought into the cell in an endosome. Hydrogen ions, and proteases, are pumped into the endosome to digest the virus. Here the protease cathepsin-L primes the spikes of the virus, and when one of these contacts the endosome membrane, it harpoons the membrane, and merges both viral, and endosome membranes. Again, this dumps the viral RNA into the cell cytoplasm, infecting the cell. This process is quite similar to that described above.

The process of a cell enveloping a virus attached to a receptor with a membrane, and bringing it inside the cell as a endosome, is known as receptor-mediated endocytosis. Below, I picture two examples of receptor-mediated endocytosis (Fcγ and ACE2).

Image

Inside an endosome is brown. Inside the cell, but outside the endosomes, is green. The middle diagram illustrates the situation with neutralizing antibodies. The antibodies physically prevent the spikes from being primed, and keep the spikes away from the endosome wall. The diagram on the right illustrates the situation with non-neutralizing antibodies. Here a few antibodies have separated from the virus, and allowed some spikes to be primed. These spikes have approached the endosome wall, and will shortly merge the viral, and endosome membranes, infecting the cell. The left diagram illustrates the situation after ACE2-mediated endocytosis. Here, there nothing to prevent cathepsin-L from priming the spikes, and nothing to prevent the spikes from merging the viral, and endosome membranes, infecting the cell.

For the covid-virus, it should be obvious that even neutralizing antibodies will lead to ADE, if there are not enough of them. Thus the waning of antibody levels will leave you liable to covid infection, and possibly open to more serious disease. For Fcγ-mediated endocytosis to work (against viruses that can escape endosomes) there needs to be a generous coating of the spike proteins by antibodies. Generally, whether ADE occurs, or not, depends on the balance between the concentrations of neutralizing antibodies, and non-neutralizing antibodies.

Fully-vaccinated now infected at triple the rate of the un-vaccinated.

The data keeps on getting worse and worse. If you are between 18 and 80 years of age, and fully-vaccinated, then you are more than three times as likely to catch Covid-19 as someone who is not vaccinated.

Age  Cases of Covid-19   Cases of Covid-19
per 100,000 of the per 100,000 of the
fully-vaccinated un-vaccinated

<18 894 1,062
18-29 2,178 722
30-39 2,501 723
40-49 2,241 642
50-59 1,703 496
60-69 1,340 370
70-79 972 356
≥80 1,055 549

The data is from Table 13 of week 10 of the British Covid-19 vaccine surveillance report. It covers the period 7 Feb to 6 Mar, 2022.

Fully-vaccinated now infected at four times the rate of the un-vaccinated.

The data keeps on getting worse and worse. If you are between 18, and 80 years old, and fully-vaccinated, then you are about four times as likely to catch Covid-19 as someone who is not vaccinated.

Age  Cases of Covid-19   Cases of Covid-19
per 100,000 of the per 100,000 of the
fully-vaccinated un-vaccinated

<18 1,454 1,711
18-29 3,118 941
30-39 4,324 1,085
40-49 3,957 955
50-59 3,303 779
60-69 2,814 572
70-79 2,161 532
≥80 2,023 775

The data is from Table 14 of week 13 of the British Covid-19 vaccine surveillance report. It covers the period 28 Feb to 27 Mar. Wow.

An amazingly blatant fraud.

Week 3, 2022, of the surveillance report introduces an amazingly blatant fraud. Here, manipulation of the data presented in Table 11(b) reduces the number of covid-19 deaths reported among vaccinated individuals by a minimum of 48%. The fraud is effected by splitting the reported deaths into two groups, and simply ignoring the deaths in one group.

In the age group 18-29 the fraud reduces    9 deaths to   1 death  (a 89% reduction in deaths)
In the age group 30-39 the fraud reduces 40 deaths to 6 deaths (a 85% reduction in deaths)
In the age group 40-49 the fraud reduces 59 deaths to 11 deaths (a 81% reduction in deaths)
In the age group 50-59 the fraud reduces 186 deaths to 44 deaths (a 76% reduction in deaths)
In the age group 60-69 the fraud reduces 418 deaths to 140 deaths (a 67% reduction in deaths)
In the age group 70-79 the fraud reduces 751 deaths to 325 deaths (a 57% reduction in deaths)
In the age group ≥80 the fraud reduces 1882 deaths to 982 deaths (a 48% reduction in deaths)

Previous to Week 3 the last column of Table 11(b) was the 7th column and it was labeled "Second dose ≥14 days before specimen date". After Week 3, what would have previously been the 7th column was divided into two columns, columns 7 and 8. These were labeled "Second dose ≥14 days before specimen date" and "Third dose ≥14 days before specimen date". Using the Week 3 data we can easily reconstruct the last column of Table 11(b) as it would have been before the fraud. We obtain;

Age
18-29 9 = (8 + 1)
30-39 40 = (34 + 6)
40-49 59 = (48 + 11)
50-59 186 = (142 + 44)
60-69 418 = (278 + 140)
70-79 751 = (426 + 325)
≥80 1882 = (900 + 982)

From this data the number of deaths, per 100,000, among the vaccinated was calculated for each age group, and recorded as the second to last column of Table 12. This column is next to the last column of Table 12, which records the number of deaths, per 100,000, among the un-vaccinated, for the purpose of comparison.

With the fraud in operation the number of deaths among "suitably triple jabbed" individuals, now reads:

Age
18-29 1
30-39 6
40-49 11
50-59 44
60-69 140
70-79 325
≥80 982

The deaths of vaccinated individuals who are "suitably double jabbed" but not "suitably triple jabbed", i.e., the deaths recorded in the new column 7, are simply ignored, even though they form the majority of the deaths. As before, the last (the 8th) column of Table 11(b) is fed into the second to last column of Table 12, where the (now much reduced) numbers of deaths, per 100,000, among the vaccinated, are compared with the number of deaths, per 100,000, among the un-vaccinated.

This fraud is quite outrageous. In fact, this fraud is so egregious that those responsible for it should be fired and never allowed to work in the public sector again.

Weeks 2, and 3, 2022, of the surveillance report can be found here and here.
Tables 11(b) and 12 from Week 2 can be found here.
Tables 11(b) and 12 from Week 3 can be found here.

Like I said, an amazingly blatant fraud.

The "vaccines" now increase sickness and death for everyone.
In particular, this is true for those over 80 years old.


The following data is, again, from the United Kingdom Health Security Agency (UKHSA).

Lets look at the (covid-19) death data for those ≥80 years of age, from week 3, 2022 (the fraud) onwards:

.    Deaths per 100,000
A B C
week03 39 309 270
week04 57 322 265
week05 78 326 248
week06 103 324 221
week07 114 280 165
week08 120 243 124
week09 120 190 70
week10 110 152 42
week11 101 141 40
week12 90 134 44
week13 84 122 37

Deaths per 100,000 means deaths per 100,000 per 28 day period ending with the stated week.
Column A is deaths among those "suitably triple jabbed" per 100,000 per 28 day period.
Column B is the deaths among the un-vaccinated per 100,000 per 28 day period.
Column C is Column B minus Column A.

I must emphasize that the above data only records deaths due to covid-19. It does not record any deaths due to adverse reactions to the vaccines.

So Column C is the number of deaths that are prevented for every 100,000 people who are vaccinated. If this number is negative then it records the number of deaths caused by the vaccines (per 100,000 vaccinated).

Graphing Column C we can see that as it approaches zero it levels off (from week 10 onwards). This is due to those presenting the data finding some fraud to keep the data positive, or simply making up the data. Anything, to keep the data from proving that the vaccines are killing more than they are saving.

Image

Anyway, after manipulating the data for the weeks 10, 11, 12, and 13, the evil people decided that the data was henceforth always going to show that the vaccines are killing more than they are saving, so they stopped publishing the data. To provide an excuse for this they had to arrange for the UK Government to stop paying for covid-19 testing, so that is what they did. In the week 14 surveillance report they state:

From 1 April 2022, the UK Government ended provision of free universal covid-19 testing for the general public in England, as set out in the plan for living with Covid-19. Such changes in testing policies affect the ability to robustly monitor covid-19 cases by vaccination status, therefore, from the week 14 report onwards this section of the report will no longer be published.

Actually, it is obvious they are lying to you. For hospitalization, and death, their claim is clearly false, as the patient's names can easily be matched against vaccination records to provide the data, just as before. However, a partially true excuse is better (to deceive you) than no excuse at all.

Remember, the evil people's job is to lie to you. To lie to you in such a way that you believe the lies are the truth.

The relevant pages from the covid-19 surveillance reports can be found here.

Previously, this very data was used to justify the vaccine mandates. The argument was that the vaccines are saving more than they are killing. This is no longer true. What is now true, is that;

The vaccines are killing more than they are saving.

As time goes on the vaccines are likely to kill far, far more, than they save. Exactly how many more will not be known as they have chosen to stop reporting the data.

The 2020 lockdowns cost some 160,000 American lives.

The economic cost of the lockdowns has been huge. The number of lives lost to the lockdowns has been enormous. Here we estimate the number of United States lives lost to the lockdowns during the year 2020. Below are the weekly non-covid deaths for 2019 and 2020 (from late March) as recorded by the CDC (Centers for Disease Control and Prevention).

----------------------
2019 NON-COVID 2020
DEATHS
----------------------
3/30 56675 59990 3/28
4/6 56598 62660 4/4
4/13 55491 63585 4/11
4/20 54468 60512 4/18
4/27 53656 59254 4/25
5/4 53987 56864 5/2
5/11 53478 56355 5/9
5/18 53578 55986 5/16
5/25 53695 55034 5/23
6/1 52727 54090 5/30
6/8 53141 54392 6/6
6/15 52646 54299 6/13
6/22 52290 54650 6/20
6/29 52209 55173 6/27
7/6 52344 55774 7/4
7/13 51931 56708 7/11
7/20 51649 56646 7/18
7/27 51662 56725 7/25
8/3 51410 56624 8/1
8/10 51747 56535 8/8
8/17 51023 57083 8/15
8/24 51022 56822 8/22
8/31 51162 55957 8/29
9/7 51836 55812 9/5
9/14 51633 55587 9/12
9/21 51757 55975 9/19
9/28 52757 56821 9/26
10/5 52564 56111 10/3
10/12 53090 57501 10/10
10/19 54338 56053 10/17
10/26 54049 56862 10/24
11/2 54087 57172 10/31
11/9 55699 59744 11/7
11/16 55886 59244 11/14
11/23 56199 59612 11/21
11/30 55465 59171 11/28
12/7 57303 60573 12/5
12/14 57658 62941 12/12
12/21 57424 62512 12/19
12/28 58458 63003 12/26
-----------------------
2,148,792 2,306,412
-----------------------

Each date is a Saturday.
The second column is the number of non-covid deaths for the week (in 2019) ending on the date in the first column.
The third column is the number of non-covid deaths for the week (in 2020) ending on the date in the fourth column.
The non-covid death numbers for 2019 are just the usual morbidity numbers (covid played no part here).
The 2019 non-covid death numbers are as provided by the CDC here.
The 2020 non-covid death numbers are as provided by the CDC here.
The last row is the totals of the columns 2 and 3.
Some deaths in Dec 2020 will be vaccine related.

From this one can conclude that the 2020 lockdowns caused around 2,306,412 - 2,148,792 = 157,620 extra deaths in the U.S.

Consider also, that many of the covid deaths were in reality non-covid deaths.


The Covid-19 Scam & Vaccines.

This used to be (and will be again) the top of the article.

A new section on the Covid-19 vaccines can be found below.

The latest VAERS (Vaccine Adverse Event Reporting System) data, repackaged to make it readable, can be found here. (WinZip opens .gz files)

This file lists 77,827 Covid-19 sequences and their mutations.

The Covid-19 HOAX can be seen in the way Covid-19 spread.

It spread to the whole world but jumped over the major Chinese cities.

You know Shanghai, Beijing, Guangzhou, Hong Kong, etc. On March 16, about 2 months after the Wuhan lockdown,

Beijing Municipality had only 442 confirmed cases of Covid-19 (population 20 million),
Shanghai Municipality had only 353 confirmed cases of Covid-19 (population 23 million),
Guangdong Province had only 1,357 confirmed cases of Covid-19 (population 104 million),
Hong Kong Region had only 141 confirmed cases of Covid-19 (population 7 million).

Get that... it didn't appreciably spread (before or after the Wuhan lockdown) to any of the major Chinese cities.

But there was a tremendous spread of the disease (before the Wuhan lockdown) to Iran and Italy.

How's that?


The Washington Post reported that 5 million people left Wuhan between January 10 (the start of the Chinese New Year travel rush) and the lockdown.[1]

Get that... at the height of the uncontrolled epidemic, five million leave Wuhan for elsewhere in China, but do not appreciably spread the disease. They spread it to many other cities, but very few catch the disease.

But a very small number from Wuhan, somehow, massively spread the disease to Iran and Italy.

How's that?


Already we have very strong evidence that Covid-19 was deliberately spread. The disease was observed to spread rapidly throughout Wuhan indicating it was very contagious, yet millions left Wuhan for the new-year celebrations in their ancestral towns, and spread the virus throughout the whole of China, but very few caught the disease, indicating the disease is hardly contagious at all. Then it suddenly becomes very contagious in Iran, and Italy.

And what about Africa?

As of April 16, there were only 16,500 confirmed cases of Covid-19 in all of Africa.

Get that... only 16,500 cases in all of Africa. Africa, which has seen massive Chinese investment accompanied by over a million Chinese workers.

How's that?


And what about the spread of the Delta variant. What good are the lockdowns, travel restrictions, and isolation. The Delta variant charges right past them all. Do they think we are stupid? This is further very strong evidence that Covid-19 is being deliberately spread. (Actually, since the PCR tests do not differentiate the Delta variant, it is possible that a great many cases are simply being labeled the Delta variant, whether they are or not. In this way the "breakthrough cases" can be blamed on a scary new variant, rather than admit that the vaccines simply do not work as effectively as claimed against the original varieties.)

Image

The above graphic from the Los Angeles Times shows the daily Covid-19 deaths (14 day average) per 100,000 people, for each continent. Note that Covid-19 was never much of a problem in Africa and Asia, even though the RNA data showed that it had been found right across Africa, and Asia, by March/April 2020. This is incredibly strong evidence that Covid-19 has been deliberately spread (mainly to the rich countries).

Notes: Guangzhou is the capital of Guangdong Province.
See below for the March 16 record of the confirmed cases in each of the Chinese Provinces/Municipalities.
The Wuhan lockdown occurred on January 23. All flights from Wuhan stopped on January 23. Flights resumed on April 8 when the Wuhan lockdown was lifted. With the opening on April 8 you were free to visit China and see everything for yourself. Two weeks of isolation was required upon entry.

So the early evidence showed that Covid-19 is not particularly contagious.

However, the media pushed the story that Covid-19 was both very contagious, and very dangerous.

Since the beginning, there has been a coordinated effort to exaggerate the dangers of Covid-19.

This has been admitted by officials in Italy, and England.

"But Prof Ricciardi (Scientific Adviser to Italy's Minister of Health) added that Italy's death rate may appear higher because of how doctors record fatalities. "The way in which we code deaths in our country is very generous in the sense that all the people who die in hospitals with the coronavirus are deemed to be dying of the coronavirus." From here or here.

Prof Ricciardi also said: "On re-evaluation by the National Institute of Health, only 12 per cent of death certificates have shown a direct causality from coronavirus (Covid-19), while 88% patients who have died have at least one pre-morbidity – many had two or three."

The UK's Chief Scientific Officer, Sir Patrick Vallance, stated: "It is worth remembering again that the ONS (Office for National Statistics) rates are people who've got Covid on their death certificates. It doesn't mean they were necessarily infected because many of them haven't been tested. So we just need to understand the difference."

Policies designed to spread Covid-19 to Care Homes.

On March 25th, 2020, New York Governor Cuomo issued an executive order forcing the transfer over 4,500 Covid-19 patients from hospitals to their nursing homes (also called old-age or care homes). In the following weeks the nursing homes saw 6,000 deaths from Covid-19. The decision drew fire as soon as it was announced from medical experts, nursing home operators, and the families of residents. However, it was forced through anyway. Similar orders were given in a number of other states. See here.

When the Justice Department requested data (26 August 2020) from governors Andrew Cuomo of New York, Phil Murphy of New Jersey, Tom Wolf of Pennsylvania and Gretchen Whitmer of Michigan, on their orders requiring nursing homes to admit Covid-19 patients, Cuomo and Whitmer dismissing it as a political charade saying that "At least 14 states - including Kentucky, Utah and Arizona - have issued similar nursing guidance all based on federal guidelines...." See here.

Playing Russian roulette: Nursing homes told to take the infected. California, New Jersey and New York have made nursing homes accept Covid-19 patients from hospitals. Residents and workers fear the policy is risking lives. That is the title of this New York Times article.

You could make a strong argument that the USA's deadly coronavirus problem is largely a nursing home problem, dangerous everywhere but far more prevalent in a half-dozen or so of the country's more heavily and densely populated states. What's more, many of these states enacted coronavirus response policies that likely put nursing home residents at higher risk for infection. See here.

In mid-June 2020, Republican Whip Steve Scalise announced that he had sent letters to the governors of California, Michigan, New Jersey, New York, and Pennsylvania, demanding they explain why they ignored protocols and forced Covid-19 patients into nursing homes. Scalise noted, "While nursing home residents make up 0.6% of the U.S. population, they account for 42% of nationwide Covid-19 deaths". That is, 70% of all U.S. Covid-19 deaths had (up till that time) been in care homes.

As of Nov. 24, 2020, it was claimed that 264,000 people in the United States had died from Covid-19. Of these deaths 100,033 occurred in nursing homes (long-term care facilities). That is, 38% of all U.S. Covid-19 deaths had (up till that time) been in care homes. The rest of the U.S. was beginning to catch up.

The Amnesty International Reports: Covid-19 and Care Homes.
Policies designed to kill hundreds of thousands of the elderly.


The report on the United Kingdom. Some passages from the report:

Covid-19 has had a devastating impact on older persons living in care homes in England. 28,186 "excess deaths" were recorded in care homes in England between 2 March and 12 June, with over 18,500 care home residents confirmed to have died with Covid-19 during this period. UK government decisions and failures resulted in violations of the human rights of people living in care homes, notably the right to life, to health and to non-discrimination. From discharging 25,000 patients, including those infected, into care homes; to denying care homes residents admission to hospital and imposing "do not attempt resuscitation" orders on them without due process, to failing to provide PPE (personal protective equipment) and testing to care homes. Older persons living in care homes were abandoned to die.

I guess; "people in care homes had their right to life violated", sounds better than; "people in care homes were murdered," but it is less accurate.

The following was so deceptively worded that I have added explanation (in brackets).

The Department of Health and Social Care.... adopted a policy,... that led to 25,000 patients, including those (known to be) infected (with Covid-19, and also those who were) possibly infected with Covid-19 (as they) had not been tested, being discharged from hospital into care homes between 17 March and 15 April—exponentially increasing the risk of transmission to the very population most at risk of severe illness and death from the disease. (This, while being denied) access to testing, (being denied) personal protective equipment, (while having) insufficient staff, and limited (and confusing) guidance. (As expected) care homes were overwhelmed.

Care home managers have reported to Amnesty International, as well as to the media, that they were pressured in different ways to accept patients discharged from hospital who had not been tested or who were Covid-19 positive.

I was contacted by concerned residents, saying surely we wouldn't put Covid-19 patients in care homes where the most vulnerable are? But commissioning [the council commissioning department] said, yes we are....

They endangered older people by discharging infected patients into care homes, without even providing tests and personal protective equipment.

Baroness Ros Altmann said: "care homes were left behind in the scramble for PPE, for emergency admission, ventilation and for testing... It's almost as if the system is stacked against them."

Care England has also reported incidents of supplies ordered by care homes being requisitioned for the NHS (National Health Service).

Our local hospital always had over 500 empty beds and so staff were not under pressure and they had lots of PPE. (However) we had 45 percent of the staff self-isolating and were scrambling to get PPE and even food.

By barring both oversight and family visits, the government increased the risk that care home residents would be exposed to abuses that would not be identified, reported and investigated.

It was the same in Italy. Some passages from the Italian report:

We can distinguish the transfers of Covid-19 positive patients discharged from hospitals to care homes:
1) patients from hospitals who were no longer acute but still Covid-19 positive.
2) patients from hospitals who were assumed non-Covid-19 positive, but were not tested,...

Infected patients discharged from hospitals also arrived in the same facilities. Some had not been swabbed at all (i.e., were not tested), but others had been determined positive for Covid-19 in hospital and had been sent to care homes without verifying the homes ability to assist these people safely.

The transfers of patients from hospitals to nursing homes took place continuously, without warnings, instructions or discussions.

The sending of positive Covid-19 patients discharged from hospitals to care homes.... where there were inadequate supplies of nasal swabs, and PPE, endangered the lives of residents and staff.

The managers of a care home reported that it has not been able to obtain any PPE from local health authorities for several weeks and that the small quantity that they eventually managed to buy, independently, was requisitioned by the customs authorities and redirected to hospitals.

Hundreds of patients had died, but in many homes, in Lombardy and elsewhere, swabs were rare, mostly not available at all. In many facilities, the first swabs — both for residents and operators — arrived only in the month of April, when the peak of infections and deaths had passed and thousands of residents had died. In other homes they arrived weeks later than this.

In Lombardy the situation was completely lost: we were abandoned like ships at sea without fuel, a total abandonment, they didn't even answer the phone.

Nobody is going in [to care homes], so there are no witnesses to whatever is going on.

Amnesty International report: United Kingdom (English)
Amnesty International report: Italy (Italian)
Amnesty International report: Spain (Spanish)
Amnesty International report: Belgium (French)


It is interesting that the United States branch of Amnesty International did not see fit to publish anything on the situation there.

The Spanish Amnesty International report is to a large extent damage control. This report has been carefully written to avoid all mention of hospitals sending Covid-19 positive patients to care homes. However, it has been widely reported that Covid-19 spread to care homes more rapidly in Spain than in any other country. And, if the hospitals did not spread the disease to the Spanish care homes, then how did it spread to them so quickly?

That Spanish hospitals discharged positive Covid-19 patients into care homes can be seen from here, section 3.2.2, where it says: "The guide for the prevention and control of Covid-19 in nursing homes and other residential centres indicates that if a resident has been hospitalized they may be returned to their established care home, or newly admitted to a care home, even if their PCR is still positive." The guide goes on to say that the patient should be isolated and monitored in the home for 14 days (but in many cases this was made difficult, if not impossible).

The complete Spanish Amnesty International report includes 5 short videos and 3 PDFs. You can download them here.

The New York Governor, Cuomo, refuses to say who conceived of the order (to send Covid-19 positive patients to care homes). But as you can see, the person/people who gave the order, gave it worldwide. Who has this sort of power? Perhaps Cuomo should be charged with murder to loosen his tongue.

Recently, the media has been trying to impeach Cuomo over the massive under-counting of nursing home deaths, and numerous accusations of sexual harassment. These are designed to throw the real issue into the background. However, Cuomo will eventually have to be thrown under the bus to protect those who actually designed (and understood the implications of) the policy which Cuomo carried out.

Unsurprisingly, those countries known to have adopted this policy (of sending Covid-19 positive patients to care homes) have among the highest number of deaths (per unit of population). It would be interesting to know if the other countries with very high death percentages, namely, Bulgaria, Portugal, Slovenia, and Czechia, also subscribed to this evil policy.

You may ask why the media has refused to tell you about the Amnesty International reports. You may ask why the media is protecting these killers.

Proof that homes for the aged were targeted.

The province of Ontario, Canada, has two types of homes for the aged:

Long-term Care Homes, which are administered by the Ministry of Long-term Care, and
Retirement Homes, which are administered by the Retirement Homes Regulatory Authority.

Retirement Homes are not required to provide the same level of care as Long-term Care Homes, however, many Retirement Homes are, in essence, Long-term Care Homes. Long-term Care Homes are largely government funded, whereas Retirement Homes are not. Long-term Care Homes are 54% privately run, and 46% government run. Retirement Homes are 100% privately run.

There are about 627 (licensed) Long-term Care Homes in Ontario.
There are about 770 (licensed) Retirement Homes in Ontario.

There were Covid-19 outbreaks in 272 (43.4%) of the 627 Long-term Care Homes, till Apr 7.[9]
There were Covid-19 outbreaks in 38 (4.9%) of the 770 Retirement Homes, till Apr 7.[10]

So, the Long-term Care Home outbreaks are 43.4/4.9 = 8.86 times more prevalent than Retirement Home outbreaks.

Because an outbreak is, by definition, the introduction of Covid-19 into an old-age home from the outside, the most important factor influencing an outbreak is the number of people that the residents meet from outside the home. Long-term Care Home residents would generally meet more staff (from outside the home), whereas Retirement Home residents would meet more outsiders while they were away from the home, as they are free to wander wherever they choose. Which of the two groups would meet more outsiders? One suspects that Retirement Home residents would come into contact with more outsiders than Long-term Care Home residents.

Given this, one would expect that Retirement Homes would have had a few more outbreaks than Long-term Care Homes. However, initially, Long-term Care Homes had nearly nine times the number of outbreaks. This is proof that Covid-19 was deliberately spread to Ontario's Long-term Care Homes, but not to the Retirement Homes. It appears that the list of targeted places included Long-term Care Homes, but not Retirement Homes. An administrative oversight by the spreaders?

[9] In the article: Risk Factors Associated With Mortality Among Residents With Coronavirus Disease 2019 (Covid-19) in Long-term Care Facilities in Ontario, Canada, we read "In this analysis, we documented the rapid spread of Covid-19 through Ontario's long-term care system, with a marked increase in risk of death among older residents with frailty during a brief period from late March to early April 2020 (April 7)," and "A total of 627 long-term care facilities were included in the provincial data set; of these, 272 (43.4%) were identified as having either confirmed or suspected Covid-19 infection in residents or staff."
[10] Data for the number of Retirement Homes with Covid-19 outbreaks has been collected by the Retirement Homes Regulatory Authority. It is displayed here. Click on "Timeline of Active & Resolved Outbreaks". Strictly, it should be "There were Covid-19 outbreaks in at most 38 of the 770 Retirement Homes." The data from March to July can be found here.

More evidence that homes for the aged were targeted.

In Ontario, as of June 1, there were:

1,652 (89.2%) deaths in Long-term Care Homes.[11]
199 (10.8%) deaths in Retirement Homes.[12]

So, there were about nine times as many deaths in Long-term Care Homes.

About nine times as many outbreaks has led to about nine times as many deaths.

This indicates that the severity of the outbreaks in both classes of home were similar, which is not what we have been told. Although, this is roughly what one should have expected as Long-term Care Homes, and Retirement Homes, are quite similar.[15]

Some amazing statistics.

As of 1 June, 92% of all Covid-19 deaths in Nova Scotia, occurred in Long-term Care Homes.[13]

As of 1 June, 88% of all Covid-19 deaths in Quebec, occurred in Long-term Care Homes.[13]

As of 1 June, 1,851/2,293 = 81% of all Covid-19 deaths in Ontario occurred in Long-term Care Homes.[13]

These percentages tell us that there were very few cases outside the Long-term Care Homes from which Covid-19 could naturally spread into the Long-term Care Homes. This is more evidence that Covid-19 was deliberately spread to Ontario's Long-term Care Homes. It also shows that in Ontario the disease was not actively spread to the general community. Someone got lazy?

By June 1, the Long-term Care Homes in the Canadian provinces/territories, Prince Edward Island, Yukon, Northwest Territories, and Nunavut had no cases of Covid-19 at all, and those in Newfoundland and Labrador, New Brunswick, Manitoba, and Saskatchewan had 12 cases between them (including 4 deaths).[14]

So, it seems that the spreaders lacked the manpower to tackle all the Care Homes in the more sparsely populated areas of Canada. In fact, the lack of manpower was felt globally. Remember, that as of April 16, months after the beginning of the pandemic, there were only 16,500 confirmed cases of Covid-19 in all of Africa.

[11] From here. The number of resident deaths in Long-term Care Homes, till June 1, is given to be 1,652. Note that the data before April 25 (i.e., the data concerning the first 654 deaths) has been censored.
[12] Table 2, page 7, of the article, Understanding the impact of Covid-19 on residents of Canada's long-term care homes – ongoing challenges and policy responses, states that the number of deaths in both Long-term Care Homes, and Retirement Homes, as of June 1, is 1,851. From [11] we have that the number of deaths in Retirement Homes is 1,851 - 1,652 = 199.
[13] ibid, figure 2.
[14] ibid, table 1.
[15] "Most Ontarians can be excused for confusing retirement homes with long-term care homes, since they both house older adults with care needs. The similarities are numerous: Both provide care to seniors, are regulated by government with regard to care, and have roughly equivalent numbers of homes and residents across the province. While some retirement homes focus on more independent seniors who require less care, others have stepped up their offerings in assisted living and dementia care – some even in palliative care – to become direct substitutes for long-term care homes." From here. The similarity of Retirement Homes and Long-term Care Homes can also be seen from the information presented in the image which is from this web-page.

The notation describing mutations.

As most know, one's genetic code is made up of DNA, which is basically long sequences of the four chemicals (called nucleotide bases) adenine, cytosine, guanine, and thymine. Such sequences are represented by strings of the four letters A, C, G, and T, where A stands for adenine, C is for cytosine, G is for guanine, and T is for thymine. For example, the very short string CATG represents the DNA sequence, cytosine joined to adenine, joined to thymine, joined to guanine.

The genetic code of most viruses, including the Covid-19 virus, is slightly different. It is made up of RNA which is basically long sequences of the four chemicals, adenine, cytosine, guanine, and uracil. Uracil is an unmethylated form of thymine. So RNA is quite similar to DNA. Because of this similarity, the notation for DNA is often used for RNA, with the understanding that every T in the notation represents the base uracil. As an example, the string CATG represents the RNA sequence, cytosine joined to adenine, joined to uracil, joined to guanine.

Mutations are changes in the DNA, or RNA, sequence. A mutation which involves a simple change of one of the bases for another, is written as the original base, the position of that base in the sequence, and the new base at that position, all run together. For example, the notation A25958G represents a mutation at position 25958 where an adenine base A has been replaced by a guanine base G. Such a mutation is called a single-nucleotide polymorphism, or SNP, for short.

Another type of mutation, called a deletion, is when a number of bases are lost from a sequence. For example, if a sequence has lost the four base string AGTT starting at position 669, then this is denoted AGTT669- where the dash at the right indicates the bases on the left have been lost.

Another type of mutation, called an insertion, is when a number of extra bases are added to a sequence. For example, if a sequence has gained the three base string ATC starting before the position 1075, then this is denoted -1075ATC where the dash at the left indicates the bases on the right have been added. (I am not sure if insertions are traditionally added before, or after, the position. I chose before, as it simplified the writing of a couple of scripts.)

The various clans of the Covid family.

Early in the epidemic (March) it became clear that the Covid-19 family of viruses could be divided into various clans. One of the earliest reports mentions three major clades (groups with a common ancestor) of the family, the G-clade, the V-clade, and the S-clade.

The G-clade comprised viruses with a single amino-acid change D614G in the spike protein.
The S-clade comprised viruses with a single amino-acid change L84S in the protein ORF8.
The V-clade comprised viruses with a single amino-acid change G251V in the protein ORF3.

D614G represents a change of the amino-acid, at position 614, from aspartic acid to glycine.
L84S represents a change of the amino-acid, at position 84, from leucine to serine.
G251V represents a change of the amino-acid, at position 251, from glycine to valine.

The position is from the beginning of the protein mentioned.

In time some authors described the clans by the underlying RNA changes, thus:

The G-clade consisted of viruses with (at least) the mutation A23403G.
The S-clade consisted of viruses with (at least) the mutation T28144C.
The V-clade consisted of viruses with (at least) the mutation G26144T.

A23403G represents the change of a single base, at position 23403, from adenine to guanine.
T28144C represents the change of a single base, at position 28144, from thymine to cytosine.
G26144T represents the change of a single base, at position 26144, from guanine to thymine.

The position is from the beginning of the standard Covid-19 genome.

A23403G is (almost) always found as part of the group of mutations C241T, C3037T, C14408T, and A23403G.
T28144C is (almost) always found as part of the group of mutations C8782T, and T28144C.
G26144T is (almost) always found as part of the group of mutations C14805T, and G26144T.

To put numbers to the last statements we have:

C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] (10120)
C8782T [1835] T28144C [1816] (1807)
C14805T [999] G26144T [945] (848)

where the number of individual occurrences (of the mutations), in square brackets, are compared to the group occurrence (of the mutations), in parentheses. These numbers are derived from the collection of 14,712 viral sequences that I acquired in May.

We will call G-clade viruses, the British-American strain, since their geographical distribution is;

3083United States
3045United Kingdom
452Denmark
318France
309Iceland
295Australia,...

We will call the four mutations C241T, C3037T, C14408T, and A23403G the Group of Four. This means that the British-American strain is (essentially) the viruses that have (at minimum) the Group of Four mutations.

About 80% of all Covid-19 viruses carry the Group of Four mutations. This fact is very difficult to explain.

Another way of saying this is that 80% of all Covid-19 viruses carry the D614G variant. Since there is no good explanation of this fact, the media has, as usual, resorted to lies. They claim that D614G makes the virus 7% more transmissible, and "therefore" the D614G variant has displaced the parental Wuhan virus (to the point where there is almost no Wuhan virus left). Of course, this is complete garbage. Except in the individual where D614G supposedly first appeared, the D614G and Wuhan variety will never compete (until most of the population has been infected). They will infect different bodies, and follow separate paths through the population. They do not compete. Contrary to what we are told, the parental Wuhan virus, and D614G, would both flourish. D614G could not, and would not, displace the parental virus. That you have been told it did, just tells you that you have been lied to.

We will call S-clade viruses, the Asian-American strain, since their geographical distribution is;

1235United States
134China
110Australia
81Spain
40Canada
38United Kingdom,...

and most of the early sequences are Chinese. The S-clade is (essentially) the set of viruses containing the mutations C8782T and T28144C. This has a large subgroup consisting of viruses carrying the five mutations C8782T C17747T A17858G C18060T and T28144C. These five mutations will be called the Group of Five. We will call viruses with these mutations, the American strain, as sequences which carry these five mutations (and no more) are entirely North American. We have:

C8782T [1835] C17747T [1158] A17858G [1177] C18060T [1188] T28144C [1816] (1146).

We will call V-clade viruses, the British strain, since their geographical distribution is;

458United Kingdom
98United States
70Australia
69Iceland
39Netherlands
19Greece,...

The V-clade is (essentially) the set of viruses containing the mutations C14805T and G26144T. This has a large subgroup consisting of viruses carrying the three mutations G11083T C14805T and G26144T. These three mutations will be called the Group of Three. We have:

G11083T [1477] C14805T [999] G26144T [946] (814).

I repeat a line from above as there is much to learn from it:

C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] (10120)

This tells you that:

The mutation C241T occurs in 10258 sequences (out of the 14712),
C3037T occurs in 10283 sequences,
C14408T occurs in 10283 sequences,
A23403G occurs in 10328 sequences, and
the group [C241T C3037T C14408T A23403G] occurs in 10120 sequences.

Since the mutations C241T, C3037T, C14408T, and A23403G are widely distributed over the genome they could not have all been added to the genome at the same time. However, since the number of individual occurrences of each mutation are almost the same, all four mutations had to have been added at roughly the same time. This contradiction means that the Group of Four mutations did not occur naturally.

This proves that the British-American viruses are not descendant from the Wuhan variety. Which means that the British-American viruses are a separate occurrence of Covid-19. This means that both occurrences of the virus were deliberate releases, and that both are, almost certainly, engineered. Interestingly, an effort was made to derive the Group of Four from the Wuhan sequence by faking intermediate sequences. You can read about this below.


An impossibly high rate of evolution.

In early April the data from nextstrain.org showed some 4,000 varieties of Covid-19 worldwide.

That so many varieties developed in such a short time, is impossible.

In early May I acquired a collection of 14,712 complete sequences. These sequences contained 8,047 distinct mutations.

Using the evolutionary substitution rate of 24 nucleotide substitutions, per year (i.e., 8 x 10^-4 subs/site/year), and assuming an exponential growth model, the time from the start of the epidemic can be estimated from the equation:

(24)^x = 8,047.

Solving this one finds that it would take x = 2.83 years to accumulate 8,047 mutations, so it seems the epidemic actually started a couple of years before Wuhan. How is that possible?

Was it possible that a strain of Covid-19 had been circulating for some time before Wuhan. If the disease of the strain was mild, then it would pass as the flu, or a cold, and could become widespread without being noticed.

If a strain of Covid-19 did precede Wuhan, then its disease was necessarily mild, in which case there is the intriguing possibility that exposure to it may endow resistance to the more dangerous Wuhan strain. If true, then the less virulent strain of Covid-19 could be a natural vaccine against the Wuhan strain, just like cowpox was a natural vaccine against smallpox. That this might be the case is suggested by the large number of people that appear to be naturally resistant to the virus. These people being resistant due to their previous exposure to the less virulent strain.

There was some indirect evidence that the British-American strain of Covid-19 may have predated Wuhan. However, its disease was unlikely to be mild. Certain papers, see here, here, and here, suggested that the British-American strain was probably more contagious, and more dangerous. This being because the British-American mutation A23403G produces a D614G change in the Spike protein that facilitates viral entry into human cells (via the ACE2 receptors). Since there is no direct evidence that any strain of Covid-19 preceded Wuhan, this possibility has to be discounted.

My latest Covid-19 collection has 77,827 sequences, and is from September, 2020. These sequences contain 23,693 distinct mutations. Let's calculate the time to the beginning of the epidemic from the equation;

(24)^x = 23,693.

Solving this one finds that it would take x = 3.17 years to accumulate 23,693 mutations. This places the beginning of the epidemic at about 3.17 years before September, 2020, which is 3.17 - 0.33 = 2.84 years before May 2020, which agrees with the previous estimate, 2.83. [The 0.33 years is the 4 months between May and September. The estimates here are quite rough, and that they agree so closely, is surprising.]

It should be noted that if a strain is not particularly contagious, then it is much, much easier to control.

In fact, it turns out that the Wuhan strain itself is not particularly contagious. But, if the Wuhan strain is not particularly contagious, then how did it spread so rapidly in Wuhan? Simple, in Wuhan the virus was deliberately spread. It did not appreciably spread to the rest of China simply because it was not particularly contagious. Remember, that at the height of the uncontrolled epidemic (Jan. 10 to Jan. 23) five million people from Wuhan traveled to all parts of China (for the New Year celebrations on Jan. 24) but did not appreciably spread the virus. They spread the virus throughout China, but few caught the disease.

Did Iceland have a strain of Covid-19 before Wuhan?

Between January 31 and April 1 the Icelandic company deCODE Genetics sequenced viral RNA taken from 643 Icelanders who had tested positive for Covid-19. They presented 601 sequences to GISAID. By mid-April, 41 sequences had been removed, leaving 560 sequences, 231 of these being distinct. These 231 sequences contain 326 distinct mutations, of which, 124 are unique to Iceland. [Nextstrain.org originally displayed more than three hundred of these genomes from Iceland, but has since purged all but twelve of them.]

The most commonly occurring of these native Icelandic mutations are: C5142T with 47 cases, A25958G with 29, A1321C 18, T9445C 14, T17531C 10, A4140G 10, T3034C 9, T17859C 9, and G27430A with 8.

On Apr 15, 2020, Kari Stefansson, the CEO of deCODE Genetics, stated that "Currently 291 mutations have been found in the country that have not been identified elsewhere."

That the 291 native mutations established themselves in the viral population in a few weeks is impossible to believe. Mutations/errors may be common but those that establish themselves in the population are not.

291 mutations in Iceland in 2 months is about
= 300 mutations/350,000 people/2 months
= 1,800 mutations/350,000 people/year
= 360,000 mutations/70,000,000 people/year
= 360,000 mutations in Great Britain in one year.

Does that sound likely to you?

This essentially proves that the Covid-19 virus already existed in Iceland prior to Wuhan. Or does it?

The existence of the Group of Four proves that Covid-19 is not of natural origin. After their production the viruses appear to have been kept alive in cell cultures in vials or flasks. Thus the viruses would gather mutations as time passed. This means that the epidemic would date to the production date, not the release date. This explains why the beginning of the epidemic seems to date a couple of years too early. This would also explain the explosion of variant genomes. What one was seeing was the uncovering in weeks, of mutations that had occurred over years, while the viruses were being tampered with, while awaiting eventual release.

The main clades were not due to random mutations but resulted from differences in engineering the viruses. After the engineered viruses were added to cell cultures natural random mutations would have accumulated. Thus when the disease was spread, it was spread as a cocktail of different Covid-19 variants. Each vial would have had its own signature mutations.

French man had Covid-19 before the Chinese.

Amirouche Hammar, a resident of Bobigny, Paris, fell sick with an influenza-like illness. On 27 December 2019, after 4 days of dry cough, fever, fatigue, and breathing difficulties, he drove himself to the emergency ward of the local hospital, where he was administered antibiotics, and recovered sufficiently to be able to leave on December 29. Like all respiratory samples, that of Hammar was frozen, and stored, for possible future analysis. Between 6-9 April 2020 fourteen of these stored samples were tested for Covid-19. The sample of Hammar, taken on 27 December 2019, tested positive for Covid-19. This means that he caught the disease sometime around 12 December 2019, right up there with the very first Chinese cases in Wuhan. The first Wuhan sample was collected on 24 December 2019.

You can read more about it in the paper SARS-CoV-2 was already spreading in France in late December 2019, in the "International Journal of Antimicrobial Agents," which can be downloaded from the internet or here.

The case of Hammar remains a mystery to the scientific community.

The Munich cluster. A complete fabrication.

The paper "Investigation of a Covid-19 outbreak in Germany resulting from a single travel-associated primary case: a case series," from "The Lancet Infectious Diseases," has to be the worst "peer-reviewed" article I have come across. With 41 authors, and at least 1 referee, you would assume that any obvious mistakes would have been weeded out, but this was not the case. It is so obviously wrong that its intention may have been, not to inform, but to mislead.

The article claims to document a case where Covid-19 was spread from China to Europe.

The carrier of Covid-19 was Patient 0, a Chinese business woman who traveled from Shanghai to Munich on Jan 19, 2020, to facilitate workshops, and attend meetings with her German colleagues. She showed no signs of illness during her stay in Germany, although she mentions suffering from jet-lag. She returned to China on Jan 22 where she became ill, and on Jan 26 tested positive for Covid-19. It is claimed that, although asymptomatic at the time, she passed the disease to a number of German associates, who then passed it to others. Those who tested positive for Covid-19 (by qRT-PCR) had their virus sequenced. The sequences were submitted to GenBank. Those infected were called the Munich, or Bavarian, cluster.

One of those infected, Patient 1, is claimed to have caught the disease from Patient 0. Patient 1 then passed the disease to Patient 3. Since Patient 3's only contact was with Patient 1, this certainly appears plausible, however, this turns out to have been impossible.

Consider the mutations (changes from the standard Covid-19 sequence from Wuhan) of Patients 1 and 3.

Patient 1, MT270101.1, SARS-CoV-2/human/DEU/BavPat1-ChVir929/2020, complete genome.
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- (deletion at beginning)
C241T (substitution at position 241)
C3037T (substitution at 3037)
A23403G (substitution at 23403)
CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29837- (deletion at end)

Patient 3, MT270103.1, SARS-CoV-2/human/DEU/BavPat3-ChVir1020/2020, complete genome.
ATTAAAGGTTTATACCTTCCCAGGTAACA1- (deletion at beginning)
C241T (substitution at 241)
C3037T (substitution at 3037)
A23403G (substitution at 23403)
TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867- (deletion at end)

Given these, it is impossible that Patient 3 caught Covid-19 from Patient 1.

Relative to the standard Covid-19 sequence, the virus from Patient 1 has lost (from its beginning) the segment
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT
However, the virus from Patient 3 has lost (from its beginning) only the shorter segment
ATTAAAGGTTTATACCTTCCCAGGTAACA

Also, the virus from Patient 1 has lost (from its end) the segment
CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
However, the virus from Patient 3 has lost (from its end) only the shorter segment
TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Therefore Patient 1 cannot have transmitted the virus to Patient 3, unless the virus from Patient 1 somehow found the missing segment AACCAACCAACTTTCGATCTCTTGT, and attached it to its beginning, and also found the missing segment CCATGTGATTTTAATAGCTTCTTAGGAGAA, and attached it to its end, with these attachments occurring sometime during the transmission. But this is clearly impossible.

For the same reason, the claimed transmissions from Patient 4 to Patient 5, and from Patient 5 to Patient 7, are impossible.

So, what really did happen?

The standard Covid-19 sequence is called Wuhan-Hu-1/2019 or NC_045512.2 or MN908947.3 or EPI_ISL_402125.

The GenBank ids and mutations of the Munich cluster can be found here.

Most of the mutations from the Munich cluster occur in the data many times. The exceptions being G6446A and C22323T. These being the two new mutations, one discovered in Patient 4, and the other in Patient 9. Not including those from the cluster, we have the following numbers for the mutations of interest:

10247C241T
10272C3037T
1031700A23403G
1G6446A
6C22323T
1279ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1-
52ATTAAAGGTTTATACCTTCCCAGGTAACA1-
409TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867-
159AATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29865-
838CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29837-

A virus is considered a direct descendant of Patient 1 if it carries all the mutations of the virus of Patient 1, that is, its sequence contains, at least, the five mutations ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- C241T C3037T A23403G and CCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29837-.

I checked Patient 1 against a database (of 14,712 complete sequences), and found that Patient 1 has 1,050 direct descendants, with 728 of these being distinct, and these carried 958 different mutations.

The 1,050 direct descendants of Patient 1, and their mutations, are listed here.

Surprisingly, the article claims that the Munich cluster was contained, i.e., the virus was stopped from spreading further, it was (locally) wiped out. If true, this would mean that at some other place another virus would have had to mutate (from the Wuhan virus) in exactly the same way as the virus of Patient 1, that is, it would have to gain exactly the same five mutations of Patient 1, in order to explain the 1,050 descendant sequences. That such an amazingly unlikely event has to occur, tells you that the official story is, at least in part, wrong.

Except for seven sequences from the Munich cluster, and two from the USA, all the descendant sequences of Patient 1 are also members of the much larger British-American grouping whose sequences contain the four mutations C241T, C3037T, C14408T and A23403G. This group comprises 10,120 sequences of the 14,712 sequences for which I have data. This predominant group is mainly found in Europe, and North America. It is particularly rare in Asia, with only nine such sequences from China. Explaining how this grouping came about is so difficult that no one broaches the subject.

With nearly 70% of the Covid-19 sequences being of the British-American strain, the evolutionary tree should clearly be rooted at one of the sequences which contain only the four mutations C241T C3037T C14408T and A23403G. Sequences with only these four mutations are predominantly British, with 30 (of 72 in all) being from Britain.

Getting back to the Munich cluster, it seems probable that the Chinese woman, Patient 0, had the Wuhan strain, but did not spread it while in Germany. The others in the cluster caught the British-American strain that was spreading across Europe and North America. However, there is also the possibility that Patient 0 caught the disease on return to China, or even caught the British-American strain of Covid-19 while in Germany, and took it back to China. [The British-American strain is very rare in China with only 9 such sequences found. Descendant sequences of Patient 1 occurring in China are, of course, even rarer with only 3 sequences found.]

The unaligned viral RNA data (in fasta (fast A) format) for the patients of this case is here.
The aligned viral RNA data (in fasta format) for the patients of this case is here.

In the investigation above, I missed a rather important detail. Patient 4 was the source of a G6446A mutation which was passed to Patient 5, and from there to Patients 6, 7, 8, 9, 10, 11, 14, and 16. But, transmission of the virus from Patient 4 to Patient 5 has been shown to have been impossible. So, the G6446A mutation was either made up, or Patient 5 spread (a British-American strain of) the virus to Patient 4, and the others. However, we read that;

"The possibility that patient 4 could have been infected by patient 5 was excluded by detailed sequence analysis: patient 4 had the novel G6446A virus detected in a throat swab and the original 6446G virus detected in her sputum, whereas patient 5 had a homogeneous virus population containing the novel G6446A substitution in the throat swab."

Thus the G6446A mutation was made up. And, what then of the rest of the paper? It is unlikely that the entire paper was concocted from thin air. It is more likely that the basic aspects of the case are correct, with a thin genetic fiction laid over them. It is very unlikely that the sequences have been completely fabricated, otherwise they would not contain the heads, and tails, that they do. Before, it was possible, though not likely, that the paper was an honest misreading of the facts, but the G6446A mutation shows that it is a deliberate lie.

The G6446A mutation is extremely rare with only one other case known. There are also three G6446T mutations. All four of these are from England. It is suspicious that the researchers found the virus in the process of mutating, not once, which in itself is suspicious, but twice (the G6446A and C22323T mutations). Of course, this would be much more likely if the patients were infected with a cocktail of viruses.

Another indication of fabrication is the C241T C3037T A23403G mutations carried by the viruses of all the patients. These being the British-American mutations with C14408T missing. Such combinations are very rare with only 34 sequences (not counting the 14 of the cluster itself) among the 14,712. Twenty of these sequences are from Belgium, a country conveniently close to the Munich cluster. However, in a more recent Covid-19 collection, 18 of the sequences from Belgium had mysteriously regrown a C14408T mutation. I say regrown, because it is clear that these 18 originally had a C14408T mutation that was removed.

It seems that these Belgian sequences were being setup for a transition from the Munich type to the British-American type. Thus we would have the Wuhan type transitioning to the Munich type transitioning to the British-American type. However, the tampering of the Belgian sequences was all in vain, as for some reason the attempt was abandoned. Given the Belgian sequences, and the absence of any further sequences of this type in Germany, it seems likely that the Munich sequences were also British-American sequences with their C14408T mutation removed.

Anyway, adjusting for the tampering, the geographical distribution of sequences with, at least, the C241T C3037T A23403G mutations, but without C14408T, is Belgium 20 - 18 = 2, Germany 14 - 14 = 0, Spain 3, China 3, USA 2, Taiwan 1, Sweden 1, India 1, Greece 1, Denmark 1, and Bangladesh 1, a total of 16.

[The 18 Belgian sequences that were altered are: EPI_ISL_420345 EPI_ISL_420346 EPI_ISL_420347 EPI_ISL_420348 EPI_ISL_420349 EPI_ISL_420350 EPI_ISL_420351 EPI_ISL_420352 EPI_ISL_420353 EPI_ISL_420354 EPI_ISL_420355 EPI_ISL_420358 EPI_ISL_420359 EPI_ISL_420360 EPI_ISL_420361 EPI_ISL_420362 EPI_ISL_420363 EPI_ISL_420364 EPI_ISL_420365 EPI_ISL_420366]

The geographical distributions of other possible ancestor sequences are:

C241T C3037T C14408T without A23403G has the distribution, USA 7, Saudi Arabia 1, Netherlands 1, and Australia 1.
C241T C14408T A23403G without C3037T has the distribution, USA 30, Austria 10, Saudi Arabia 2, France 2, Wales 1, Sweden 1, Iceland 1, and England 1.
C3037T C14408T A23403G without C241T has the distribution, USA 27, Turkey 19, Jordan 13, Russia 12, Australia 5, Saudi Arabia 3, Brazil 3, Israel 2, France 2, China 2, and Scotland 1.

None of these provide a believable path from the Wuhan strain to the British-American strain, which indicates that the British-American strain was a separate release of the virus. Was it released before or after the Wuhan strain. Iceland seems to imply before, but Iran, and Italy, suggest after.

This file lists all 14,712 sequences of the database, and their mutations. These 14,712 sequences contain 8,047 distinct mutations.

More tampering with the data?

It seems that the fabricators of the Lancet paper also planted the following three sequences in GISAID:

EPI_ISL_416327 2020-01-28 hCoV-19/Shanghai/SH0014/2020 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- C241T C3037T A23403G TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867-
EPI_ISL_416386 2020-01-31 hCoV-19/Shanghai/SH0086/2020 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- C241T T1216C C3037T C6091T A16205G C17977A A23403G TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867-
EPI_ISL_416334 2020-02-06 hCoV-19/Shanghai/SH0025/2020 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- C241T C1555A C3037T A9238G A23403G TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867-

The first two sequences have the same internal mutations (C241T C3037T A23403G) and same tail mutation (TGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29867-) as Patient 1, and have that same head mutation (ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1-) as Patient 3. The third sequence is the same with a couple of extra internal mutations.

All three sequences are from Shanghai, where Patient 0 was diagnosed with Covid-19, and all have dates close to the collection date of Patient 0's sample (which was supposedly Jan. 26).

These sequences were fabricated to help convince you that the completely false Lancet paper, is completely true.

Sequences containing C241T C3037T A23403G (but not C14408T) are rare everywhere, but extremely rare in China. The only other such sequences found in, or fabricated for, China, are:

EPI_ISL_451345 2020-01-24 hCoV-19/China/SC-PHCC1-022/2020 C241T C3037T A23403G
EPI_ISL_429080 2020-02-05 Guangzhou/GZMU0019/2020 C241T C3037T A23403G AAAAAAAAAAAA29892-

The paper has other indications of being fabricated.

It claims that "No specimens were available for sequencing for patients 12, 13, and 15," and that "Sequencing of patient 15 was not successful." These being contradictory claims. And since the sequence for patient 15 was submitted under the name SARS-CoV-2/human/DEU/BavPat15-ChVir1484-ChVir1536/2020 [EPI_ISL_450211], both of these claims appear to be false.

Patient 12 was supposedly the first Covid-19 case to be diagnosed in Spain. It is surprising that his virus was not sequenced. Perhaps the Spanish authorities believed this had already been done. It turns out that this was not the case as the Lancet paper states "After Spanish authorities were informed, patient 12 was isolated in hospital on Jan 30 and diagnosed with Covid-19." So the mystery remains. This may mean that the story of the Munich cluster was fabricated at a later date, and was retrospectively "made true". However, this would involve creating false news reports, etc, and placing them with false dates. Not impossible if you are a large well organized group, as the spreaders of the virus seem to be.

Of course, this completely false paper, and its spinoff, were among the main drivers for the belief in asymptomatic transmission. Although many studies (regarding asymptomatic transmission) have been done, the CDC (Centers for Disease Control and Prevention, July 10, 2020) could only say, "The relative infectiousness of asymptomatic cases to symptomatic cases remains highly uncertain as asymptomatic cases are difficult to identify and transmission is difficult to observe and quantify. The estimates for relative infectiousness are (only) assumptions based on studies of viral shedding dynamics."

Here are a couple of lines from two review articles on Asymptomatic Transmission.

"This review identified and summarised 18 case studies reporting pre-symptomatic or asymptomatic transmission. However, their level of evidence is low and is subject to a number of potential sources of bias and therefore they should be interpreted with caution.... Based on the totality of the evidence presented in this report,it seems likely that pre-symptomatic transmission is occurring. Evidence of asymptomatic transmission from asymptomatic carriers, is more limited (perhaps due to difficulties in identifying truly asymptomatic carriers); it appears plausible, but it may not be a driver of transmission."

https://www.hiqa.ie/sites/default/files ... VID-19.pdf

"Our study does not support claims that the majority of SARS-CoV-2 infections are asymptomatic. Questions remain as to the role of asymptomatic carriers in the transmission of SARS-CoV-2."

https://www.medrxiv.org/content/10.1101 ... 1.full.pdf

On another reading of the paper I found the statement "The directly observed substitution rate was two substitutions per 29903 nucleotides per 11 days, equalling 2.2×10^-3 substitutions per site, per year."

0.0022 = 2.2×10^-3 = (2/29903)*(365/11) subs/site/year [or 66 subs/year]

The fact that the mutations were on different descendant viruses cleared up the question of which mutations are counted in the calculation of the substitution rate. All mutations of descendant viruses are counted. I checked Patient 1 against a Covid-19 database (of 14,712 complete sequences), and found that Patient 1 has 1,050 direct descendants, with 728 of these being distinct, and these carried 958 different mutations. We also have that these mutations occurred between Jan 24 and mid May, over a period of say, 120 days. Thus a rough estimate of the evolutionary substitution rate for this branch can be calculated.

It is (958/29903)*(365/120) = 0.097 = 9.7×10^-2 subs/site/year [or 2,914 subs/year]

This is impossibly high. Not only is the substitution rate impossibly high, but the direct descendants spread around the world in an impossibly short time (especially since at the beginning of the period airlines had considerably reduced their services). The geographical distribution of the direct descendants is Australia 1, Belgium 36, Brazil 1, Canada 16, China 3, Colombia 54, England 22, Scotland 165, Wales 2, Germany 7, Hungary 3, Ireland 7, Japan 14, Netherlands 209, Portugal 24, Serbia 2, Spain 39, Sweden 1, Thailand 2, and USA 442.

Another "peer-reviewed" paper designed to mislead.

The paper, Clinical and virological data of the first cases of Covid-19 in Europe: a case series, from "The Lancet Infectious Diseases," also misleads the reader concerning RNA data. Similar to the last, it has a large number of authors. One guesses that the twenty-three authors are to deflect blame, so that blame cannot be pinned on any one particular author, and thus ultimately, on none of them. With the same style and intent, it appears that both of these papers were ghost written by the same people.

Among the more important pieces of data to be gathered about these first cases are the viral RNA sequences. They were indeed gathered, and here is what the paper has to say about them:

"When available, the sequence analysis of the virus of these patients showed that patients 1 and 4 compared with patient 5 correspond to two distinct events of importation. For patients 1 and 4, the virus was clustering with viruses from cases in Wuhan, Shenzhen (China), California (USA), Australia, and Taiwan, whereas for patient 5 the virus was clustering with those from Chongqing (China) and Singapore (the genetic epidemiology of SARS-CoV-2 is available online). Furthermore, the very high degree of identity of the sequences from patients 1 and 4 supports the epidemiological link between these cases and the likelihood of transmission."

From this it is clear that the data is not to their liking, so they tell you essentially nothing, give you no links to the data, and tell you to go find it on the internet, if you can. Disgusting.

The deliberate spread of the virus to a New Zealand nursing home.

While looking for evidence that the British-American strain is not that dangerous, I came across the case of the Rosewood Rest Home, located in Christchurch, New Zealand, from which 12 people died. [It turns out that the British-American strain is just as dangerous as the other strains, if not more so.]

The relevant sequences and their mutations can be found here.

It appears that most of those who died carried the six mutations C241T, C3037T, C4683T, C14408T, A23403G, and G24077T. That is, the British-American mutations plus C4683T, and G24077T. As a group C241T, C3037T, C4683T, C14408T, A23403G, and G24077T are only found in 9 sequences from (Christchurch) New Zealand.

By itself, the mutation, C4683T, has the following geographical distribution:

New Zealand 9 sequences, United States 5, China 2, Singapore 1, and Australia 1.

By itself, G24077T, has the following distribution:

Portugal 65, United Kingdom 14, New Zealand 13, Netherlands 7, Iceland 3, United States 1, Switzerland 1, Italy 1, Georgia 1, Estonia 1, and Austria 1.

There are no possible ancestor sequences containing C4683T. Well, none if you discount such unlikely possibilities as the two Chinese viruses, just mentioned above, which would have to lose two specific mutations, and gain five extra, all at once. About the same probability as being able to hold your breath free-diving to the bottom of the Mariana Trench.

All sequences containing G24077T also contain the British-American mutations, so C241T C3037T C14408T A23403G G24077T has the same geographical distribution as G24077T. Apart from one sequence from the United States they are all European. How an ancestral sequence got to New Zealand, and then immediately mutated to the Christchurch form, is a bit of a mystery.

Overall, it looks like a nasty strain of the disease was deliberately released in the nursing home to affect New Zealand Covid-19 policy. What is particularly suspect about all this, is that the New Zealand Health authorities felt that there was nothing to report here. There were no questions as to where the virus came from. There were no questions as to whether these unusual mutations could have made the virus more lethal. There was no mention of the fact that this deadly viral form was unique to New Zealand, etc, etc. It's as if they went to the trouble of sequencing the virus, then threw away the results without looking at them.

Coverup down-under.

During April, and May, 2020, the Western Sydney nursing home, Newmarch House, suffered a deadly outbreak of Covid-19. The Australian current affairs program, Four Corners, investigated the outbreak, and produced a documentary called Like the plague.

The documentary points out that Newmarch House patients were not transfered to hospitals. Why?

One reads that "NSW Health is running the testing at Newmarch House while the federal government has provided an infection control specialist (Aspen Medical) who is monitoring and reviewing all current contamination and infection control procedures at the home."

Hospitals were emptied to take the predicted hundreds of thousands of sick and dying. But when a few people from Newmarch House needed to be transfered to one of these hospitals, health officials (one guesses on the advice of Aspen Medical) refused to allow this. This is truly incomprehensible.

On May 4, 2020, the Sydney Morning Herald carried this report;

New South Wales Health authorities are investigating whether multiple sources of infection caused the devastating outbreak of Covid-19 at the Anglicare Newmarch aged care facility. The investigation comes as a 15th resident at (another) nursing home in Caddens in western Sydney died from the virus on Monday, and amid growing concern among families of residents about the facility's ability to contain the outbreak. New South Wales Chief Health Officer Dr Kerry Chant said a forensic investigation was still ongoing into how coronavirus entered the nursing home, saying it was possible a previously identified employee was not the initial source of the outbreak. "What we're trying to look at is were there any other introductions into the aged care facility at or about that time," Dr Chant said. "Was she [the employee] the first case, or had she in fact acquired it from someone else?" "We know that the [completed] genomic sequencing is showing that the virus that spread into the nursing home is a virus that was circulating in the community, there's linkages between a number of other clusters," Dr Chant said. "This is forensic detective work. We are just trying to look at whether there are missing links or missing chains."

The relevant viruses were sequenced, and detective work was conducted to map the spread of the virus. As far as I am aware, the results of this work were never made public. In fact, it appears that a great effort was made to hide away the data. The RNA sequences were almost certainly submitted to GISAID. However, GISAID has not released any Covid-19 sequence submitted from Sydney since April 19 2020. Not even one. You should contrast this with viral information from non-Sydney, New South Wales, locations. GISAID has released every non-Sydney sequence that has been submitted to them, every single one, even the ones submitted to them on July 29 2020.

With the first Covid-19 case identified at Newmarch House on 10 April, and given 4 or 5 days to get the sequencing, etc, done, the timing of the GISAID black-out is rather suspicious. Chant mentions the investigation showed linkages between clusters. It seems likely that the detective work did indeed provide a link between various disease clusters, a link that indicated that the virus was being deliberately spread.

I have recently acquired a collection of 40,132 Covid-19 sequences (and now 77,827). In this file I list all the Covid-19 sequences submitted to GISAID from New South Wales, that is, all the Covid-19 sequences from New South Wales in their database. For sequences in the collection I have also added the mutations carried by the sequences. Sydney sequences are labeled "Australia/NSW/Sydney". Sequences from outside Sydney are labeled simply "Australia/NSW". "No Data" indicates that the sequence has been submitted, and thus in their database, but not in the collection.

In order to investigate this further I have acquired another collection. This one has 77,827 Covid-19 sequences.
This file lists the 77,827 sequences and their mutations in .cvs format.
This file lists the 77,827 sequences, as just above, but with more detailed information concerning the location.
These 77,827 sequences contain 23,692 distinct mutations.

Unfortunately, the new collection did not provide any of the missing NSW sequences, not even one.

And, just in case you think it is only GISAID, and Nextstrain, that are hiding/fudging the facts, I present the number of sequences from Australia that are among the 15,217 currently (Aug. 9 2020) being distributed by NCBI;

Australia: Victoria 1379
Australia: Northern Territory 31
Australia: South Australia 4
Australia 4
Australia: Queensland 2

Note that the number of sequences from New South Wales, Australia, is zero (the 4 sequences labelled simply Australia are from Queensland). Given Sydney is the most populous city, and has had significant Covid-19 outbreaks where we know viruses were sequenced, there is a suspicious lack of New South Wales sequences. NCBI stands for the National Center for Biotechnology Information, and is a United States company.

To further investigate this I downloaded the 23,529 sequences currently (Sep. 23 2020) available from NCBI. The number of sequences from New South Wales, Australia, is still zero. Here are the current statistics for Australia:

Australia: Victoria 5317
Australia: Northern Territory 34
Australia: South Australia 4
Australia: Tasmania 200

This 8.8M gzipped file contains the 23,529 sequences in fasta format.
The uncompressed file from NCBI is 687M. It makes you wonder why they do not compress their files.
The details, including mutations, of this collection are listed here in .csv format.

One notes that Sydney has 27 sequences with the following unusual head and tail mutations:

ATTAAAGGTTTATACCTTCC---226-bases-missing---GGTGTGACCGAAAGGTAAGA1-
CAATCTTTAATCAGTGTGTA---189-bases-missing---AAAAAAAAAAAAAAAAAAAA29675-

I will call them ATTAA*TAAGA1- and CAATC*AAAAA29675- for short.

Sequences carrying (at least) these two mutations are not found anywhere else in Australia. The geographical distribution of such sequences is United States 780, Australia 27, Mexico 25, Jordan 23, Ecuador 5, Singapore 1, a total of 861. I hope I do not have to point out that China is not on this list.

The 861 include whole groups of known sequences with their ends severely trimmed. Of course, this is all very, very strange. Such a collection of sequences could not develop naturally. It is like someone took a pair of scissors to a large number of existing sequences, and trimmed the ends of all of them at exactly the same two points. This was so unusual that I had to take a closer look.

I will call the 861 sequences having the CAATC*AAAAA29675- mutation, simply 29675-sequences.

I looked for ancestor sequences, and found that nearly all 29675-sequences have an ancestor sequence that was collected on the same day, and at the same place, as the 29675-sequence. In total I found 745 [29675, ancestor] pairs, with both members of each pair having the same collection date, and location. This is obviously not from a natural occurrence. So, which are fake, the 29675-sequences, or the ancestor sequences associated to them?

Since 29675-sequences have been found by at least three different laboratories, it seemed likely that the 29675-sequences were not simply the result of some strange glitch in the sequencing process. The three laboratories being Westmead Hospital, University of Sydney, Australia [27 sequences], the Instituto Nacional de Investigación en Salud Pública, Ecuador [5 sequences], and Duke-NUS Medical School, USA [1 sequence]. I said "at least three" because the entry providing the originating lab has been deleted from 827 of the 861 records, so there may well have been many more than three.

Almost all the records with the originating lab entry deleted have "The Scripps Research Institute, USA" as the submitting lab. And, what of the ancestor component of the [29675, ancestor] pairs? Well, 744 of the 745 ancestor sequences list "The Scripps Research Institute, USA" as both the originating lab, and submitting lab. Maybe the Scripps Research Institute should be asked a few questions.

Adding a near full length sequence extending each of the 29675-sequences is a way of hiding the 29675-sequences, whereas faking the 29675-sequences gains nothing.

From all this it is clear that the ancestor component of each of the pairs is entirely fabricated.

You can view the 745 [29675, ancestor] pairs here. They have the four line format:

ID of 29675-genome; Collection date of sample; Length of genome; Name of genome; Location;
Mutations of 29675-genome (common mutations in red)
Mutations of associated ancestor genome (common mutations in red)
ID of ancestor genome; Collection date; Length of genome; Name of genome; Location;

An example being:

MT810526 2020-03-20 29409 SARS-CoV-2/human/USA/SEARCH-1660-SAN/2020 United States/San Diego/California
ATTAAAGGTT---265-bases-total---GAAAGGTAAG1-C3037T C14408T A20268G A23403G CAATCTTTAA---229-bases-total---AAAAAAAAAA29675-
ATTAAAGGTTTATACCT1- C241TC3037T C14408T A20268G A23403G
EPI_ISL_494721 2020-03-20 29886 hCoV-19/USA/CA-ALSR-1660/2020 United States/California/San Diego

Note that both the 29675-sequence, here MT810526, and the ancestor sequence, here EPI_ISL_494721, invariably have the same collection date, and location. Note also that the 29675-sequence location is invariably written country/city/state while the ancestor sequence is written country/state/city, and that the same number, in this case 1660, is invariably used in both the 29675 and ancestor sequence names.

So, how did the 29675-sequences originate? That is a hard one to answer. Over four hundred different existing viruses have had their ends trimmed to give the 861 sequences of 29675-type. It seems that many different viruses must have been found together in one place, when their ends were cut off at exactly the same two points (relative to the standard sequence). Perhaps an RNA cutting/editing protein was added in order to change one or more of the viruses in some desired way, and this protein was accidently left in a number of vials, each of which contained a cocktail of covid-19 viruses. Of course, such an editing protein should have been thoroughly removed from the mixture. However, in some cases it appears that it was not successfully purged, and in time, it amputated the ends of each covid-19 virus in the vial.

The 29675-sequences are closely related to outbreaks on cruise ships. Two cruise ships with 29675-sequences docked at San Diego. One of these was the Disney Wonder. The Disney Wonder had previously stopped in at New Orleans, Louisiana. Both San Diego and New Orleans had an outbreak of viruses of the 29675-type. Of course, Sydney Australia also had a 29675-type outbreak. One assumes this was the type of the Newmarch House outbreak, and this led to the above mentioned cover-up. Newmarch House also had a connection to cruise ships, as Aspen Medical staff who had worked on the cruise ship Ruby Princess later worked at Newmarch. The 25 sequences of 29675-type from Mexico are all from Tijuana which neighbors San Diego. The 23 sequences of 29675-type from Amman, Jordan, probably have a connection to the US military.

Since the latest collection (originally from GISAID) did not provide any of the missing NSW sequences, and some of the collection's data appears to have been tampered with (e.g., the dates of certain Spanish sequences), I started looking for older collections. And, the very first one, from June 27, provided 393 of the missing NSW sequences. I had guessed that what was being hidden was a bunch of 29675-sequences, and 229 of them were, but there were also 164, 29677-sequences.

A 29677-sequence is what you would expect, i.e., a sequence with the tail deletion
ATCTTTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACAT
TTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACAATGCTA
GGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGT
AGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA29677-.
It is usually paired with the head deletion
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTC
TTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTC
GGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGT
CGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGT
TTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTG
TGACCGAAAGGTAA1-

I will call these two mutations ATCTT*AAAAA29677- and ATTAA*GGTAA1- for short.

The 393 new sequences, and their mutations, can be found here.
The old plus new sequences together are listed here.

The first 29675-sequence was collected on Feb. 3 in Singapore.

The second 29675-sequence was collected on Feb. 28 in Sydney.
The first 29677-sequence was collected on Feb. 28 in Sydney.

Following the natural order of things the 29677-sequences should have occurred first.

Everything is weird. One guesses that these Sydney sequences had to be part of the same Covid-19 cocktail.

All 29677-sequences are from Sydney, Australia, except one from Spain, and one from Portugal:

EPI_ISL_454103 2020-03-20 2020-05-28 hCoV-19/Portugal/PT0387/2020 Portugal
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAAC1- C241T C3037T C14408T A23403G C26408T GGG28881AAC ATCTT*AAAAA29677-
EPI_ISL_455336 2020-02-29 2020-05-29 hCoV-19/Spain/LaRioja201277/2020 Spain/LaRioja
C8782T T9477A C14805T G24040T G25979T T28144C C28657T C28863T ATCTT*AAAAA29677-

Such a distribution is hard to explain.

A strange feature is that three or four days after the number of 29677-viral-sequences peaked, they disappeared from the face of the planet, never to be seen again. The 29677-sequences (just like the 29675-sequences) are actually amputated versions of many different genomes. In fact, the 29677-sequences are amputated versions of 115 different preexisting genomes. So, how is it that all 115 different amputated genomes choose to disappear at exactly the same time, and just after their peak occurrence? The answer is obvious. They all disappeared when the viral cocktails from particular vials were no longer spread.

Here is a graph recording the numbers of 29675- and 29677-sequences collected each day between Feb. 23 and May 20.

Image

Another tail mutation, CCATG*AAAAA29837- for short, is extremely common. A virus with the CCATG*AAAAA29837- tail mutation will be called simply a 29837-virus, and a sequence with such will be called a 29837-sequence. There are 25,303 such 29837-sequences in the 77,827-collection. 24,711 of these are paired with the head mutation ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1-. The 29837-viruses (just like the 29675-viruses and 29677-viruses) are descendants of amputated versions of many different preexisting genomes. In fact, the 29837-viruses are descendants of the amputated versions of 672 different preexisting viruses/genomes.

It is notable that in the earlier 14,712-collection there are zero 29837-sequences, zero 29675-sequences, and zero 29677-sequences.

Overall, the main variants of the virus appear to be only mildly contagious, so to keep the pandemic going the virus has to be actively spread.

It seems that initially aircraft and cruise ships were used to spread the virus. Old-age homes were also targeted.

This explains why China recovered so quickly from her dose of the virus. Although the virus had been actively spread in Wuhan, leading to reports of the virus being very contagious, the lockdown, and the lack of old-age homes, kept the spreaders from spreading it further. Thus they moved on to easier, or more hated, targets. Western countries proved particularly soft targets as the disease could be spread to the numerous old-age homes. Such old-age homes are rare in Asia as the older population mostly lives with their children. Since the virus is only mildly contagious, the lockdown soon killed off the little that had previously spread to the rest of China. It seems the spreaders expected the virus to be much more contagious than it turned out to be, as they spread it just before the biggest mass movement of people anywhere on the planet, Chinese new year.

Cruise ships used to spread the virus.

5 April 2020: New South Wales Police Commissioner Mick Fuller announces a criminal investigation into the operator of the Ruby Princess cruise ship after the death of 10 passengers from coronavirus. This was to be conducted by the NSW Police homicide squad.
15 April 2020: A Special Commission of Inquiry into the Ruby Princess was initiated to curtail the police investigation. Some months later the Commissioner reported that everything was an unfortunate string of accidents and errors. The idea here is to use the report of the special Commission as an excuse to wind down, and quietly drop, the police investigation. However, this will probably not stop the group of 800 passengers who are pursuing a class action lawsuit. (Those pursuing this class action should be very wary of their leaders, as it is unlikely these people are, in reality, on their side.)
22 April 2020: NZ Customs announced an investigation into Ruby Princess cruise-ship staff concerning Covid-19 clusters in New Zealand. It seems that this "investigation" has also been quietly dropped.

Accidental, or not, the Ruby Princess certainly spread the virus far and wide:

Image

Here is a false declaration of health sent from the Ruby Princess to the Auckland District Health Board. It was obtained by stuff.co.nz under the Official Information Act. The declaration is dated 16 March, and claims to have been submitted at the port of Tauranga, however, the cruise of the Ruby Princess was cut short, and the ship never visited Tauranga.

On 15 March a declaration of health would have been sent from the Ruby Princess, then at the port of Napier, to the Bay of Plenty District Health Board. This would have been needed to dock at the port of Tauranga, as planned for March 16. After changing one word, Napier, to Tauranga, and the (first instance of the) date to the 16th, and presumably the registration number, the same document was sent to the Auckland District Health Board. This would have been needed to dock at Auckland, as planned for March 17. Doing this had the effect of hiding the true health situation on March 16. Why was it necessary to hide the true health situation of the Ruby Princess? One has to assume that someone on board the ship was aware that it was carrying Covid-19.

And another paper designed to mislead.

While searching for a relation between mutations, and death rate, I came across this article.

The article reads very strangely, and it took some hours to decipher. First, they mention nine very important mutations, but never tell you what they are. However, you can find them labeling diagrams at the end of the article. They are C8782T, C17747T, A17858G, C18060T, T28144C, C241T, C3037T, C14408T, and A23403G. The last four you are already familiar with, they are the four mutations of the British-American strain. They mention that C241T, C3037T, C14408T, and A23403G are mainly European, and exist as a group, as you already know.

Then they mention that the mutations C17747T, A17858G, and C18060T are mainly American, and are nearly always found together as a group. This was intriguing as I had entirely missed this grouping. I wondered about the other two mutations C8782T, and T28144C. It didn't take long to find out that these two plus C17747T, A17858G, and C18060T form a tight group of five mutations. So, why did the authors report only a group of three?

It eventually dawned on me that the reason for the overall obscurity of the article, and the misdirection, is to prevent the reader discovering the group of five. This is because the group of five is impossible to explain as a natural consequence of the official Covid-19 tale. So what do we know about the group of five?

The group of five [C8782T, C17747T, A17858G, C18060T, and T28144C] occur in 1146 sequences.

To gain some idea of just how tight this group of five is, consider the following:

Sequences containing C8782T, C17747T, A17858G, and C18060T, without T28144C = 3.
Sequences containing C8782T, C17747T, A17858G, and T28144C, without C18060T = 5.
Sequences containing C8782T, C17747T, C18060T, and T28144C, without A17858G = 0.
Sequences containing C8782T, A17858G, C18060T, and T28144C, without C17747T = 19.
Sequences containing A17858G, C17747T, A17858G, and C18060T, without C8782T = 3.

There are 164 sequences which carry only these five mutations (and no more). They are entirely from North America, with 160 from the USA and 4 from Canada. Hence, the evolutionary tree of the American strain is clearly rooted in North America, that is, this strain started in North America, and spread elsewhere.

Descendant sequences, that is, sequences containing at least the group of five mutations are predominantly American, with 1042 (of 1146 in all) from the USA. The distribution is: USA 1042, Australia 49, Canada 26, Costa Rica 1, England 2, Iceland 15, Mexico 4, Puerto Rico 3, Taiwan 3, and Uruguay 1.

Explaining how the group of five developed from Wuhan is probably impossible, but anyway it is so hard to explain that explanations are not offered, and the topic is hidden away.

As to the correlation of mutations to death rate, the authors state that they have removed from consideration all sequences which are the same as the standard Wuhan genome. This invalidates their results. The 2nd edition says nothing of what the correlations actually represent. In the 1st edition one has;

"The frequencies of specific sites for each country were calculated. The death rate was estimated with Total Deaths/Confirmed Cases based on the data from Johns Hopkins resources on April 22th, 2020. The correlation coefficient between death rate and frequencies of specific site or haplotype in different countries was calculated using Pearson method."

With this as a strategy, I can see why they deleted this sentence in the 2nd edition. Better to say nothing.

More viruses mysteriously regrow their tails.

For the period 2020-01-19 until 2020-02-20 (the first month of the America Covid-19 epidemic) every single American viral sequence had lost AAAAAAAAAAAAAAAAAAAAA, or more, from it's tail. In particular, all potential ancestors of the group of five had AAAAAAAAAAAAAAAAAAAAA, or more, missing from their tail. Here is a list of all the potential ancestors of the group of five from that first month:

2020-01-19 MN985325 C8782T C18060T T28144C AAAAAAAAAAAAAAAAAAAAA29883-
2020-01-19 MT233526 ATTAAAGGTTTATACCTT1- C8782T C18060T T28144C ATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29866-
2020-01-19 MT246667 ATTA1- C8782T C18060T T28144C AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29871G
2020-01-22 MN997409 C8782T G11083T T28144C C29095T AAAAAAAAAAAAAAAAAAAAA29883-
2020-01-23 MN994467 G1548A C8782T C24034T T26729C G28077C T28144C A28792T AAAAAAAAAAAAAAAAAAAAA29883-
2020-01-25 EPI_ISL_407214 C8782T C18060T T28144C AAAAAAAAAAAAAAAAAAAAA29883-
2020-01-25 EPI_ISL_407215 C8782T C18060T T28144C AAAAAAAAAAAAAAAAAAAAA29883-
2020-01-28 EPI_ISL_410045 T490A C3177T C8782T C24034T T26729C G28077C T28144C AAAAAAAAAAAAAAAAAAAAA29883-
2020-02-06 EPI_ISL_411954 C8782T T28144C G28878A G29742A AAAAAAAAAAAAAAAAAAAAA29883-
2020-02-11 EPI_ISL_411956 C8782T T18603C T18975A A19175C C27925T T28144C C29095T AAAAAAAAAAAAAAAAAAAAA29883-

Then on 2020-02-20 something strange happened. A sequence turned up with a full tail. The first one. It's id was EPI_ISL_413456. It also carried the group of five mutations. Then a few more a couple of days later. Then there were 889 sequences carrying the group of five mutations and having a full tail. How does a true believer explain this? I guess the only possible explanation is for the group of five, plus full tail, to have been introduced to North America from outside, sometime around 2020-02-20, when the first case magically appears. But it turns out that there is nowhere (from outside North America) it could have come from. Here is a full list of possible ancestors countries and mutations:

111110 USA 510 Australia 9 Canada 9 England 2 Iceland 14 Taiwan 2 Uruguay 1
111100 USA 2
011110 USA 2
101110 USA 1 Australia 1 Canada 13
111010 Iceland 1
100110 USA 2
100010 USA 91 Australia 15 Canada 1 China 14 Denmark 1 England 4 France 1 Germany 1 Japan 1 Jordan 1 Kazakhstan 1 New Zealand 2 Russia 2 Saudi Arabia 12 Scotland 15 Senegal 2 United Arab Emirates 1 Unknown 1
100000 Scotland 1 Wales 1
010000 Wales 1
000100 USA 1 England 1
000010 USA 1 South Korea 1
000000 All countries 6235

The mutations are represented by the initial binary number. For example, 100010 is shorthand for 1 mutation C8782T, 0 mutations C17747T, 0 mutations A17858G, 0 mutations C18060T, 1 mutation T28144C, and 0 mutations at the end (i.e., a full tail). The unlisted binary numbers. e.g., 110110, represent combinations of the mutations that have not been found anywhere in the world. Clearly, all ancestor sequences must have a full tail, i.e., the last digit of the binary number must be zero.

I guess, if one is really desperate, one has to look at the 14 Chinese sequences among those labeled 100010. This is a real, real long shot, for such ancestor sequences need to gain the three missing mutations, C17747T, A17858G, and C18060T, and at essentially the same time. To make matters even worse, 13 of the 14 sequences carry other mutations which make it impossible for them to be ancestors. So, one is left with EPI_ISL_413858, from Guangdong province, which carries only the mutations C8782T, and T28144C (and has a full tail). Even if you believe this extremely unlikely triple-jump happened, you are still left with a host of problems, like; How did the virus EPI_ISL_413858 get to America? And if it did, why did it spread in America but not in China? etc, etc.

When you are reduced to believing such incredibly unlikely events, the story you believe is probably wrong. Here, it is much, much easier to believe the group of five is native to North America, and independent of Wuhan.

Tight groupings in the data.

I adjusted the script used in the last section in order to find all significant groupings among the twenty most common mutations. This is what I found:

C1059T G25563T == First Group of Two (3624 of 14712 sequences carry these mutations)
C8782T T28144C == Second Group of Two (1807 sequences; includes the Group of Five)
G11083T C14805T G26144T == Group of Three (814)
C241T C3037T C14408T A23403G == Group of Four (10120)
C241T C3037T C14408T A23403G G25563T == Group of Four + G25563T (4329)
C241T C3037T C14408T A23403G C1059T == Group of Four + C1059T (3585)
C241T C3037T C14408T A23403G C1059T G25563T == Group of Four + First Group of Two (3564)
C241T C3037T C14408T A23403G GGG28881AAC == Group of Four + GGG28881AAC (2953)
C241T C3037T C14408T A23403G G25563T == Group of Four + AATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- (790)
C241T C3037T C14408T A23403G A20268G == Group of Four + A20268G (732)
C241T C3037T C14408T A23403G C18877T == Group of Four + C18877T (439)
C241T C3037T C14408T A23403G C1059T G25563T C27964T == Group of Four + First Group of Two + C27964T (359)
C8782T C17747T A17858G C18060T T28144C == Group of Five (1146) < Second Group of Two

These are the major groupings. The Group of Four+Two is a group among the descendants of the Group of Four, and the Groups Four+Two+X are groups among the descendants of the Group of Four+Two, etc. How these groupings developed is impossible to explain without throwing away the official explanation.

So you can judge which are tight groupings, the number of individual occurrences, in square brackets, are compared to the group occurrences, in parentheses.

C1059T [3654 sequences] G25563T [4426 sequences] (3624 sequences as a group)
C8782T [1835] T28144C [1816] (1807)
G11083T [1477] C14805T [999] G26144T [946] (814)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] (10120)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] G25563T [4426] (4329)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] C1059T [3654] (3585)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] C1059T [3654] G25563T [4426] (3564)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] GGG28881AAC [2994] (2953)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] AATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT1- [1285] (790)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] A20268G [745] (732)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] C18877T [469] (439)
C241T [10258] C3037T [10283] C14408T [10283] A23403G [10328] C1059T [3654] G25563T [4426] C27964T [384] (359)
C8782T [1835] C17747T [1158] A17858G [1177] C18060T [1188] T28144C [1816] (1146)

That C3037T and C14408T were both in exactly 10,283 sequences was surprising. I checked in the 40,132 collection and found C3037T was in 31,212 sequences and C14408T in 31,169. Together, they were in 31,040 sequences.

Yet another paper designed to mislead.

The preprint "Identification of novel missense mutations in a large number of recent SARS-CoV-2 genome sequences," is another example of a paper that was deliberately designed to point researchers in the wrong direction. First, I wondered about this statement:

"On April 11, 2020, there were 547 SARS-Cov-2 sequences deposited in GenBank, from which, we downloaded 474 complete or near-complete genomes..."

So, I downloaded the Covid-19 sequences available from GenBank (over 8000), removed duplicates, animal sequences, and sequences of length less than 29000. This left me with 7683 sequences. According to GenBank's own data, 1555 sequences had been submitted to them by April 11. So why were only 547 sequences available for download?

My guess is that GenBank deliberately held back the submitted data while giving certain people access to it so they could concoct a story that hid their nefarious activities. Once they had established the narrative, the raw data (perhaps slightly adjusted) could be released to the scientific public.

This process allows a certain degree of cherry-picking. If you cherry-pick 474 sequences from 1423, as they were likely able to do, then people will ask questions, but if 474 have been chosen from 547, then that sounds reasonable.

The mutations of this GenBank collection are listed here.

So, if there was cherry-picking, what was its purpose? Consider this statement:

"Our analysis highlights 5 frequent new mutations that have emerged since late February 2020. These mutations are: one each missense (non-synonymous) mutation in orf1ab (C1059T), orf3 (G25563T) and orf8 (C27964T), one in 5'UTR (C241T), one in a non-coding region (G29553A). The final mutation (G29553A) was found to be almost exclusive to the US isolates."

Our authors report the following five new mutations: C1059T G25563T C27964T C241T G29553A.

From the 1423 sequences they (probably) had available to them, we have

308 C1059T mutations (22% of the 1423)
335 G25563T 24%
34 C27964T 2%
65 G29553A 5%
499 C241T 35%

We also have the following mutations that the authors managed not to find. Each of them more prevalent than those they did find.

519 C3037T 36%
506 C14408T 36%
517 A23403G 36%

The percentages for earlier dates decrease proportionally to zero. For later dates they increase proportionally until each of C241T, C3037T, C14408T and A23403G is 65%.

As you know, from above, C241T, C3037T, C14408T and A23403G exist as a group. If you find the mutation C241T, as the authors did, then you also find the mutations C3037T, C14408T and A23403G. They are tied together. It is impossible to find the mutation C241T without finding the other three. Yet our authors managed to miss this very large elephant grazing in a very small china shop. So, hiding the British-American strain seems to be one object of the paper.

In fact, it is even worse than just stated. As you can see four (C1059T G25563T C27964T C241T) of the five mutations found by the authors are actually part of the Group of Four+Two+One (C241T C3037T C14408T A23403G C1059T G25563T C27964T). That is, four of the five mutations found by the authors are part of this tight grouping of seven. That is, four of the five mutations found by the authors are so closely tied to C3037T, C14408T and A23403G that it is literally impossible to miss them. Yet "miss" them they did.

Another peer-reviewed, but mostly wrong, paper.

The peer-reviewed paper "Phylogenetic network analysis of SARS-CoV-2 genomes," states: "Finally, to ensure comparability, we truncated the flanks of all (RNA viral) sequences to the consensus range 56 to 29,797, with nucleotide position numbering according to the Wuhan 1 reference sequence." Doing this invalidates their results.

So, the authors trimmed the RNA to some "consensus range" to ensure "comparability". That is, they deleted the information that was stopping them getting the results they wanted. The "consensus range" was the minimum trim necessary to be rid of all the undesired mutations, so the authors understood what they were doing. Maybe they figured that future sequences would justify this fudging of the facts.

To see if ignoring the lower and higher numbered mutations actually made any difference, I checked the twelve sequences (EPI_ISL_406036 EPI_ISL_410713 EPI_ISL_411951 EPI_ISL_412029 EPI_ISL_411929 EPI_ISL_406031 EPI_ISL_412116 EPI_ISL_410536 EPI_ISL_406844 EPI_ISL_406597 EPI_ISL_410714 EPI_ISL_410546) claimed to be descendant from the Sydney virus EPI_ISL_408977. None of these cases of paternity were supported by the facts (i.e., the full sequences). You can find the results here. I didn't check any further.

Another complaint is that the supplement shows the bat coronavirus RaTG13, GenBank id MN996532.1, is linked to the standard Covid-19 sequence by the mutations T28144C C8782T T29095C C18060A C3037T G4255T C6031T C7420T C10138T A11707G C12115T T15597C C17373T C18828T C21859T T22303C C24034T C25587T, and T25645C. This is wrong. The stated mutations are just a small sampling of the 1109 mutations by which the bat sequence and the standard sequence differ.

Is it possible that the bat virus BatCoVRaTG13 jumped species directly to the Wuhan strain? In a word, no. The two only have 96.2% sequence similarity, that is, there are 1189 base differences. These 1189 base differences make up the 1109 mutations mentioned above.

Note that the first two mutations mentioned in the paper are incorrectly named. T29095C should be C29095T, and T8782C should be C8782T.

Covid-19 is NOT from bats; at least not naturally.

It is claimed that SARS-CoV-2 came from bats, with pangolins acting as an intermediary host. However, this is impossible as the spike proteins of all bat and pangolin coronaviruses have monobasic S1/S2 cleavage sites, whereas, that of SARS-CoV-2 has a multibasic S1/S2 cleavage site. The spike proteins of the human coronaviruses OC43, and HKU1, both have a multibasic cleavage site. This is strong evidence of genetic engineering.

Bat RaTG13 669 GICASYQTQTNS----RSVA 684
SARS-Cov-2 669 GICASYQTQTNSPRRARSVA 688

Above, we compare the S1/S2 cleavage sites of SARS-Cov-2 and the bat virus RaTG13. It has been found that coronavirus spike proteins need to be cleaved/cut in two places in order for them to induce fusion (virus-cell, or cell-cell fusion). These two places are called the S1/S2 and S2' cleavage sites. In the case of SARS-Cov-2 and RaTG13 the S1/S2 cleavage occurs after the bold R and before the S. The bat S1/S2 cleavage motif R is not efficiently cleaved by common enzymes. However, if the arginine amino acid R is replaced by the sequence RRAR then it is well-known, and has been well-known for decades, that the ubiquitously found enzyme, furin, recognizes this sequence/motif and cuts the spike protein very efficiently during the virus' production (in the trans-Golgi-network) by your cells. It has also been known for decades that this greatly increases the pathology of the virus.[22][40][41]

Now SARS-Cov-2 just happens to have the amino-acid sequence PRRA inserted just before the bat S1/S2 cleavage motif R. This just happens to create the S1/S2 multibasic furin cleavage motif RRAR which just happens to dramatically increase the pathology of the bat virus. No similar furin cleavage motif is found in any bat or pangolin virus.

The only other significant difference between the SARS-Cov-2 and RaTG13 spike proteins occurs in the receptor binding domain (RBD). Here the RBD of RaTG13, which does not bind very efficiently to human ACE2-receptors, has been swapped for another RBD, one that just happens to bind extremely well to human ACE2, one we are told is from a pangolin virus. It can be proved that the swapping of the RBDs has been engineered by looking at the ratio of synonymous mutations to non-synonymous mutations within the RBD, and comparing this to the ratio outside the RBD.

The following table compares the S1/S2 and S2' cleavage sites of the SARS-CoV-2 spike protein, with the S1/S2 and S2' cleavage sites of bat viruses spike proteins. It has been copied from [23 Figure 1]. With its furin cleavage motif SARS-CoV-2 is clearly the odd one out.

Image

Further evidence that Covid-19 is not natural.

If the amino-acid sequence PRRA was introduced by a recombination event, then the nucleotide sequence coding for it, that is CCT CGG CGG GCA, must have come from some other related virus. However, the segment CGG CGG cannot be found in any coronavirus spike cleavage sequence. In fact, the CGG CGG motif is not found among the spike cleavage sequences of any known virus, strongly indicating that SARS-CoV-2 has been engineered. [42] Two further papers concerning the genetic engineering of SARS-CoV-2 are [49] & [50].

Covid-19 Cover-up in Rome.

The researchers, Bartolini, Bordi, Capobianchi, Carletti, Castilletti, Colavita, Ippolito, Lalle, Nicastri, Rueca, of the National Institute for Infectious Diseases (INMI), in Rome, have put their names to the following three papers/preprints;

[1] Molecular characterization of SARS-CoV-2 from the first case of Covid-19 in Italy.
[2] Virological characterization of the first two Covid-19 patients diagnosed in Italy.
[3] SARS-CoV-2 Phylogenetic Analysis, Lazio Region, Italy, February-March 2020.

Here are some quotes from [1];

"On January 29, 2020, two Chinese spouses (patient 1, female; patient 2, male), coming to Italy as tourists from Hubei province, were hospitalized at the National Institute for Infectious Diseases "L. Spallanzani", Rome, with fever and respiratory symptoms."

This couple were Italy's first Covid-19 cases.

"A virus isolate was obtained from the sputum of patient 1, with cytopathic effects evident 24 h post-inoculation. At the time of writing, virus isolation from the nasopharyngeal swab sample collected from patient 2 was not successful, likely due to the lower viral load, therefore no further analysis was performed on the virus detected in patient 2. Next-generation sequencing was performed on the respiratory samples from patient 1 and on the primary isolate, prior to any further passage, by using the Ion Torrent S5 platform." [1; page 1]

We have the following quotes from [2];

"On January 29th, 2020, two spouses, a 66-year-old woman (Patient 1, Pt1) and a 67-year-old man (Patient 2, Pt2) visiting Rome for vacation, were admitted at INMI, as possible Covid-19 cases. Both patients arrived in Italy on January 23rd from Wuhan, Hubei Province, China, and since January 28th presented relevant respiratory symptoms." [2; page 6]

"First samples collected at diagnosis (nasopharyngeal swabs on both patients and sputum of Pt1) were immediately inoculated into the cell culture for isolation purpose. The follow-up samples (were stored).... Next generation sequencing was performed using Ion Torrent S5 platform as described in [9]." [2; page 5]

Here it is implicit that both the viruses of both Patient 1 and Patient 2 were sequenced. Further, we read;

"The partial Pt2 sequence was very similar to the sequence of Pt1, and consistent with the full genome sequence of the strain isolated by the national reference center (EPI_ISL_412974) from Pt2 nasopharyngeal swab."

This completely contradicts what the INMI authors have previously said, above.

The important point here is that Patient 2's virus was isolated and sequenced. In fact, it was isolated from Patient 2's nasopharyngeal swab. The partial sequences (MT008022 = EPI_ISL_406959; MT008023 = EPI_ISL_406960) of Pt1 and Pt2 are tiny identical 322-base sequences (which were not worth submitting). Their mention is probably just to confuse the meaning of the sentence. In [3] we read;

"We named the sequences INMI3-INMI10 for their detection at National Institute for Infectious Diseases and analyzed them together with the previously published INMI1 and INMI2 [1], along with all the sequences from Italy posted to GISAID database by April 11, 2020." [3; page 1]

INMI1 and INMI2 were the names given to the viruses of Patients 1 and 2. INMI3-INMI10 were the names for the next 8 Covid-19 viruses sequenced by the group. We are told that the INMI group sequenced INMI1 and INMI3 to INMI10 using the Ion Torrent S5 platform. However, instead of sequencing Patient 2's virus, INMI2, themselves, they had it sequenced by the "national reference center," which, of course, may be another reference to themselves, but according to the GISAID database (EPI_ISL_412974) it is the Virology Laboratory of the Army Medical Center. EPI_ISL_412974 is recorded as:

EPI_ISL_412974 2020-01-29 2020-03-01 hCoV-19/Italy/SPL1/2020 Italy/Rome G11083T G26144T

where the format is: id, collection date, submission date, full name, location, and mutations.

So, what was it that caused patient 2's virus, INMI2, to be treated so differently?

One also finds the contradictory statements:

"Full genome sequences of Pt1 were obtained by NGS from both virus isolate and clinical sample (nasopharyngeal swab)." [2; page 7]

"The reads from the two respiratory samples of patient 1 were merged to obtain a better coverage along the virus genome, and in this paper are referred to as data from the clinical sample." [1; page 1]

So what is going on here?

It seems the virus of Patient 1 must have been sufficiently different from that of Patient 2 to call for a cover-up.

After reading these papers it is clear that their purpose was to blame China for the spread of the virus to Italy, even if there was no evidence for this. When the viral sequences of Patients 1 and 2 turned out to be different, this made it unlikely that one of the pair had caught the virus from the other, and actually points to the couple being deliberately infected, which points away from China. So, the differences in the sequences had to be covered up.

Reading further one finds;

"Considering the consensus sequences, two non-synonymous changes with respect to the Wuhan-Hu-1 NCBI Reference Genome were observed in the sequence from the clinical sample from patient 1: G11083T, leading to L3606F change in Orf1a, and G26144T, leading to G251V change in Orf3a. One additional synonymous substitution in Orf1a (A2269T) was detected in the isolate but not in the corresponding clinical sample. All variants were confirmed by Sanger sequencing." [1; page 1]

This is incorrect. This quote implies that the G11083T mutation was found in the isolate sequence of Patient 1. However, the G11083T mutation is nowhere to be found in the isolate sequence.

The isolate sequence from patient 1 is MT066156 = EPI_ISL_410545 = Italy/INMI1-isl/2020.
The clinical sequence from patient 1 is MT077125 = EPI_ISL_410546 = Italy/INMI1-cs/2020.

From the database we have;

EPI_ISL_410545 2020-01-29 2020-02-17 Italy/INMI1-isl/2020 Italy/Rome [isl=isolate]
A2269T G26144T GACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29868-
MT066156 2020-01-30 2020-02-14 ITA/INMI1/2020 Italy
A2269T G26144T GACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29868-

EPI_ISL_410546 2020-01-31 2020-02-17 Italy/INMI1-cs/2020 Italy/Rome [cs=clinical sample]
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAG1- G11083T G26144T TGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29842-
MT077125 2020-01-31 2020-02-17 ITA/INMI1/2020 Italy
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAG1- G11083T G26144T TGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29842-

As you can see, the claimed G11083T mutation is not among the mutations of the isolate. On further investigation it turns out that position 11083 is recorded as indeterminate, i.e., as the letter N. All the other 29,866 bases were successfully determined (as either A,C,G or T). Only this one base, at the important (to this case) position, 11083, was not successfully determined. What are the chances of that? Anyway, this means that certain software will display the (potential) MT066156 mutations as:

MT066156 2020-01-30 2020-02-14 ITA/INMI1/2020 Italy
A2269T G11083N G26144T GACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29868-

where the G11083N is a potential mutation, but, as yet, not determined to be such, and this looks a bit like a G11083T mutation. In any case, a potential mutation seems good enough for these researchers. Of course, in reality, the G11083T mutation was never part of the isolate sequence, and the N had to be added to the isolate sequence to even suggest that it might have been.

In fact, reading between the lines, it seems likely that patient 1's sequence was initially the isolate sequence, and patient 2's was initially the clinical sequence. Something like this:

patient 1's sequence
== the wife's sequence
== isolate sequence/EPI_ISL_410545
== A2269T G26144T GACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA29868-

patient 2's sequence
== the husband's sequence
== EPI_ISL_412974
== G11083T G26144T
== clinical sequence/EPI_ISL_410546 without end mutations

And when it was pointed out that the couple's viral sequences were different, the husband's viral sequence was called a variant of the wife's, and the two were added together to form something new that was also called a clinical sequence, to further confuse the issue. Whether patient 2's sequence was initially the clinical sequence, or not, makes no difference to what has been said above. This is just my guess at what actually happened. In any case, things were done to hide the differences between the couple's viral sequences.

The database shows that Patient 1 and Patient 2 were the only people in all of Italy with viruses belonging to the V clade (i.e., they had at least the mutation G26144T). The nine sequences from Italy in the V clade are clearly just copies of the viral sequences of Patient 1 and Patient 2. All other Italian sequences were clade G (i.e., they had at least the mutation A23403G). This has also been noted here:

"The analysis of sequence data shown in GISAID indicates that the initial introduction of SARS-CoV-2 in Italy through 2 infected tourists in January was effectively contained, and no further circulation of similar clade V strains has been so far detected." [3; page 1]

Note also that the mutation A2269T is only found in these sequences from Rome. It has not been found anywhere else in the world. In particular, it has never been found in China. So when the INMI group claimed that everything was consistent with the couple bringing the virus from China, they were lying.

The Italian sequences plus mutations are listed here. By the way, there is a suspiciously small number of Italian sequences in all the collections.

Train travel tells a story about Covid-19.

It is obvious that the story we are being told about the Covid-19 epidemic is very wrong.

Everyday 59 trains (32 bullet trains and 27 normal trains) leave Wuhan for Beijing.[2]
These trains carry between 600 and 1200 passengers.
Of course, for the period around Chinese New Year, every train would have been packed.
However, let us assume that only 50 passengers on each train from Wuhan end up in Beijing.
So every day 59 * 50 = 2,950 people from Wuhan go to Beijing.
The virus circulated in Wuhan for roughly 40 days before the authorities took action.
Therefore 59 * 50 * 40 = 118,000 people from Wuhan end up in Beijing.
These 118,000 + those arriving by plane + those arriving by automobile, result in 442 confirmed cases of Covid19.

Everyday 155 trains (103 bullet trains and 52 normal trains) leave Wuhan for Changsha (Hunan Province).
Similarly, we have 155 * 50 * 40 = 310,000 people from Wuhan ending up in Changsha.
These 310,000 + those arriving by plane + those arriving by automobile, result in 1,018 confirmed cases of Covid19.

Everyday 127 trains (85 bullet trains and 42 normal trains) leave Wuhan for Zhengzhou (Henan Province).
Similarly, we have 127 * 50 * 40 = 254,000 people from Wuhan ending up in Zhengzhou.
These 254,000 + those arriving by plane + those arriving by automobile, result in 1,273 confirmed cases of Covid19.

And, so on,....

Over the same time period, a few thousand Chinese from Wuhan arrive in Iran.
These are supposedly responsible for 12,729 confirmed cases by March 16.

Over the same time period, a few thousand Chinese from Wuhan arrive in Italy.
These are supposedly responsible for 21,157 confirmed cases by March 16.

Regarding the last two estimates: What I know is that the number of one-way tickets from Wuhan to Paris in the first quarter 2019 was 4,232. Using this 90 day period as a proxy, this is 4,232 * 4/9 = 1,880 passengers for the 40 day period of interest. The "few thousand" passengers from Wuhan to Italy & Iran is a guess based on this. More accurate numbers would be welcome.

Summing up we have:

More than004,000 Chinese from Wuhan visit Hong Kongresulting in00,141 confirmed cases.
More than082,000 Chinese from Wuhan visit Shanghairesulting in00,353 confirmed cases.
More than118,000 Chinese from Wuhan visit Beijingresulting in00,442 confirmed cases.
More than090,000 Chinese from Wuhan visit Chongqingresulting in00,576 confirmed cases.
More than158,000 Chinese from Wuhan visit Nanjingresulting in00,631 confirmed cases.
More than310,000 Chinese from Wuhan visit Changsharesulting in01,018 confirmed cases.
More than0254,000 Chinese from Wuhan visit Zhengzhou0resulting in01,273 confirmed cases.
More than234,000 Chinese from Wuhan visit Guangzhouresulting in01,357 confirmed cases.
Less than001,000 Chinese from Wuhan visit Iranresulting in12,729 confirmed cases.
Less than001,000 Chinese from Wuhan visit Italyresulting in021,157 confirmed cases.

The confirmed cases are those reported on March 16, 2020.

How is it visitors from Wuhan to major Chinese cities have an almost zero transmission rate?

Yet we are told that visitors from Wuhan to foreign countries have a very high transmission rate.


How can this be?

Wuhan is in the middle of China.

How could the disease bypass all the major Chinese cities and massively infect huge numbers in Iran and Italy?

Why didn't the disease infect large numbers in the major Chinese cities (before the lockdown)?

Conclusion: The story we are being told about Covid-19 = SARS-CoV-2 is a big lie.

Plane travel tells the same story as Train travel.

We use the one-way bookings from Wuhan to various countries in the first quarter of 2019 to estimate the number of airline passengers.[4] The top ten destinations from Wuhan were:

Thailand74,185
Japan29,710
Taiwan25,752
Hong Kong 021,852
Malaysia19,105
Korea18,623
Australia15,020
Cambodia13,456
USA13,267
Singapore12,959

Note that neither Iran or Italy are in the top ten destinations.

We are interested in 40 days from the 90 day period, so we multiply by 4/9. We have:

More than32,971 Chinese from Wuhan visit Thailandresulting in0,0827 confirmed cases of Covid19.
More than13,204 Chinese from Wuhan visit Japanresulting in01,140 confirmed cases of Covid19.
More than11,445 Chinese from Wuhan visit Taiwanresulting in0,0215 confirmed cases of Covid19.
More than09,712 Chinese from Wuhan visit Hong Kong 0resulting in0,0386 confirmed cases of Covid19.
More than08,491 Chinese from Wuhan visit Malaysiaresulting in01,624 confirmed cases of Covid19.
More than08,277 Chinese from Wuhan visit Korearesulting in09,037 confirmed cases of Covid19.
More than06,675 Chinese from Wuhan visit Australiaresulting in02,044 confirmed cases of Covid19.
More than05,980 Chinese from Wuhan visit Cambodiaresulting in0,0087 confirmed cases of Covid19.
More than05,896 Chinese from Wuhan visit USAresulting in046,450 confirmed cases of Covid19.
More than005,759 Chinese from Wuhan visit Singaporeresulting in0,0509 confirmed cases of Covid19.

The source of this information is the OAG (Air Travel Intelligence) Traffic Analyzer.

Conclusion: The virus was deliberately spread to certain areas. Other areas were forgotten about.

The Covid-19 antibody test.

The easiest to use Covid-19 test looks for antibodies that the body has used to fight the disease. It does not tell how long ago the disease occurred. The assumption is that it MUST BE very recent. But that is only because "everyone" believes that everything started with Wuhan, which it didn't.

Such a test is BioMedomics COVID-19 IgM/IgG Rapid Test: BioMedomics has developed and launched one of the world's first rapid point-of-care lateral flow immunoassays for the diagnosis of coronavirus infection. The test has been used widely by the Chinese CDC (Center for Disease Control and Prevention) to combat infections and is now available globally. This test detects both early marker and late marker, IgM/IgG antibodies in human finger-prick (capillary) or venous whole blood, serum, and plasma samples.... BioMedomics Rapid IgM-IgG Combined Antibody Test for COVID-19 is used to qualitatively detect IgG and IgM antibodies of the novel coronavirus in human serum, plasma or whole blood in vitro. [The U.S. was slow on the uptake, and it was only on March 16 that the FDA recommended this product for healthcare workers at the point-of-care. Previous to this qRT-PCR (quantitative real-time polymerase chain reaction) was used.]

I also came across this pamphlet which states: "Results from the COVID-19 IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma) should not be used as the sole basis to diagnose or exclude SARS-COV-2 infection or to inform infection status."

The pamphlet also states: "The COVID-19 IgG/IgM Rapid Test Cassette.... shows some cross reactivity with samples positive for SARS-CoV antibody and Rheumatoid Factor. It is possible to cross-react with samples positive for MERS-CoV antibody. Positive results may be due to past or present infection with non-SARS-CoV-2 coronavirus strains, such as coronavirus HKU1, NL63, OC43, or 229E."

So, if in the past you have had SARS-CoV-1, MERS-CoV (very unlikely) or one of the common cold corona-viruses HKU1, NL63, OC43, or 229E, (more likely) then you just might test positive for Covid-19.

Corona-viruses have a worldwide distribution, and cause 10-15% of common cold cases. Covid-19 is a corona-virus.

Now, if you have had one of the common cold corona-viruses like HKU1, NL63, OC43, or 229E, and thus test positive for Covid-19, and die of pneumonia, then you will probably be counted as one of those who died of Covid-19, even though you never had the disease.

It is said of the corona-viruses OC43 and 229E: "They are among the viruses that cause the common cold. Both viruses can cause severe lower respiratory tract infections, including pneumonia, in infants, and the elderly," which sounds a lot like the corona-virus Covid-19.

The deliberate spreading of the virus was probably only to China, Iran, and Italy, where a more virulent strain was released. Since the Chinese strain had almost zero transmission rate, it quickly died out. The initial high transmission rate in Wuhan was due to the disease being deliberately spread. Spreading the virus before the Chinese New Year travel extravaganza suggests that the plan was to infect all of China.

The article: "Rates of evolutionary change in viruses: patterns and determinants" states:

For nearly all RNA viruses examined, overall rates of nucleotide substitution fall in the range of 10^-2 to 10^-5 nucleotide substitutions per site, per year (subs/site/year), with most of the viruses exhibiting rates within one order of magnitude of 1 x 10^-3 subs/site/year. For an RNA virus with a genome of 10,000 bases, this is equivalent to the fixation of 10 substitutions per genome, per year.

10^-2 = 0.01, 10^-3 = 0.001, 10^-4 = 0.0001 and 10^-5 = 0.00001.

The nucleotide substitution rate is also known as the evolutionary rate.

Nextstrain.org actually gives you a rate estimate of around 25 substitutions per year. The estimate is hidden under the Clock option. Click the Clock option and it appears on the data graph. 25 substitutions per year seems incredibly wrong when you even have individual genomes with that many substitutions, and that supposedly within a couple of months, not a full year.

25 substitutions per year corresponds to 25/30,000 = 0.0008 = 8 × 10^-4 substitutions per site per year.

Assuming an exponential growth model, this means that after one year, 25 mutations (per genome) will have become fixed in the population. After two years, 625.

The mutation/error rate.

The mutation rate should really be called the error rate as the changes in the RNA sequence are caused by their "duplication" protein not being very accurate. The error/mutation rate is (usually) defined as the average number of errors created in genomes of viral progeny, per base, per replication cycle (mut/nuc/rep). Covid-19 actually has an error checking protein so should have a low error/mutation rate compared to other RNA viruses.

The error/mutation rate can be high but the substitution/evolutionary rate low.

For an error/mutation to count in the evolutionary rate it has to become established in the population which rarely occurs. Typically, a virus with a one nucleotide error/mutation will sit in a sea of billions of viruses without that particular error, and will not become established in the population.

Nextstrain.org

There are a few reasons to worry about nextstrain.org's reporting of the Covid-19 epidemic. The main reason is their giant culls of hundreds of sequences. For example, on April 07, 552 of 3087 genomes just disappeared. Similarly, on April 22, 1902 of 3170 genomes disappeared, while 329 were added. On May 19, 1340 of 5669 genomes disappeared.... So, why were they fudging the data? Were they "cherry picking"?

To try and understand what was happening I listed those sequences kept, and those deleted (in the April 22 cull) in this file. Those kept are in column one, those deleted are in column two. What is notable, is that 93% of the Welsh varieties, 87% of the Scotch varieties, and 68% of the English varieties, just disappeared. What is it that makes the British varieties so unwanted? One thing, is that the British varieties are very different to the standard Wuhan genome (i.e., their Divergence is large). This suggests that the "cherry picking" is done to maintain the fiction that all varieties are from the Wuhan genome.

The Divergence provides a measure of the "closeness" between two genomes (of similar size). It is defined to be the difference in the number of nucleotide mutations between the two. When comparing genomes of different sizes you need to divide the Divergence by the genome length.

Here are a few genomes with large Divergence that appeared on nextstrain, only to soon disappear:

SouthAfrica/RO2606/2020 Divergence=35
Fujian/IM3520004T/2020 Divergence=35
England/20142083004/2020 Divergence=34
Wales/PHWC-24DF0/2020 Divergence=32
England/20144037404/2020 Divergence=30
Columbia/GVI-97181/2020 Divergence=30
DRC/KN-0051/2020 Divergence=30....

There are more here if anyone is interested. All but 5 of these have now been purged. Concerning those 5;

Senegal/640/2020 has had its Divergence changed from 25 to 20 then 19 then 18.
Senegal/328/2020 has had its Divergence changed from 24 to 21 then 18 then 17.
India/nimh-0116/2020 has had its Divergence changed from 22 to 18 then 17.
Luxembourg/LNS0522318/2020 has had its Divergence changed from 21 to 17.
Norway/2093/2020 has had its Divergence changed from 24 to 11.

I would imagine by now that the last five have also disappeared, or been further trimmed.

Concerning nextstrain.org's presentation; I have been asked how a data point can differ from the standard Wuhan genome (that is, have non-zero Divergence), yet report "No nucleotide mutations". The reason is that the missing mutations are reported on the branches leading to the data point in question. If you add up the number of mutations reported on the branches, plus any reported for the data point itself, you get the number of points of difference, that is, the Divergence. I have illustrated this for the data point Senegal/640/2020. You can view the explanatory picture here. An active version can be found here (it seems that the sequence Senegal/640/2020 has disappeared).

The Senegal/640/2020 sequence is defined by stating its differences to the standard Wuhan genome. The differing nucleotides are [C3037T] [C241T A23403G] [C14408T] [G25563T] [C1059T] [G11083T] [A2825G A2826C T2827A A2831C G29372A C29375G T29377C A29381C G29384T + 2 more]

Their total, that is, the Divergence, is = 1 + 2 + 1 + 1 + 1 + 1 + 11 + 0 = 18.

The term "AA mutations" stands for amino acid mutations. Some nucleotide substitutions do not cause any change in the amino acids produced. Thus, there is no change in the protein sequences, and usually no physical change in the organism. These substitutions are called synonymous.

If you think that the above sequence Wales/PHWC-24DF0/2020 with Divergence of 32 is impressive, here is a Turkish genome with Divergence 60. Comparing it to the standard Wuhan genome, as usual, it is:

C100A T580A G779C T946A T1100G C1101T A1106T A1119C A1134T G1156A G1210A C1225A T1359C G1397A C1420T G1470A C1473T A1475C G2250A C2455T A2475T G2549C T2586A G2591A G2612C G2715T A2932G C3117T G3146C C3787T C4084T C7392T T10532A C11232T G11234A C13476T C13492T C14286T G14310A T14394A C14407A G14430A G14443T T14682G G14710A T14740C C14763A G14773T T14808A C15101A T15119A G15958A C19763A T26396A T26551C C26753T C27103T G28109T T28688C G29742T.

The virus is called hCoV-19/Turkey/6224-Ankara1034/2020 and has GISAID id EPI_ISL_417413.

And here is another monster. This Malaysian virus has Divergence 69.

It is called hCoV-19/Malaysia/186197/2020 and has id MT372483 and GISAID id EPI_ISL_417919.

It is defined by its differences from the standard Wuhan genome, which are:

-320T T2628- G2632T -2633A C2636T A2679C T2737A A10215G A10225C T11104C T12113C A13409G C13424T G13469A T15242A G15416A T15417A T15428A G15429A T15432A G15433A T15437A G15438A C15441A G15449A C15469T G15475A A15478G T15969A -16267G A16270- C16271T T17549C A17553G T17582A G17601A T17618A T17643A C17644A T17647A T17650A T17652A G17667A T17673A C17845T A17871G T17873C C17874T G17887A T22907A A23122T A26945G G26946C C27106T A27107G T27108C -29699G A29700G T29709- T29710A A29812G T29817A A29819T G29825T A29827G -29864AAAAA T29867A G29868A C29870A

Note that this Malaysian branch would have diverged from the Wuhan branch about 1.3 years ago.

There is a very interesting virus from the United States (Wisconsin) that has Divergence 50.

It is called hCoV-19/USA/WI-GMF-00928/2020 and has GISAID id EPI_ISL_426161.

It is defined by its differences from the standard Wuhan genome, which are:

T78G C241T A739G C1059T C2933T C3037T C9866T C12400T C14408T A14747G A20755C A21536T T21537A T21539A A21550T A21551C A23403G C25366T A25367C A25368G C25373G A25377T A25379T G25563T C26447T A26449C G26452T T26453C C26455G C26456T T26457A T26462A C26464G G26466T G26467C G27364T A27365T G27366C C27367G A27369T C27371T A27372C A27373T G27376T A27383T T28238A G28239T T28240C G28242C T28245G

It is mainly of interest because this virus also occurs on nextstrain.org where it has Divergence 12. The mutations presented by nextstrain.org are C241T A739G C1059T C2933T C3037T C9866T C12400T C14408T A14747G A20755C A23403G G25563T which form a subset of the mutations of EPI_ISL_426161 just listed above. They have been marked in red. You can find the nextstrain.org version here.

It would be interesting to hear why the other 38 mutations were thrown away.

There is another very interesting virus from Wuhan China.

It is called hCoV-19/Wuhan/HBCDC-HB-04/2019 and has GISAID id EPI_ISL_412900.

It is defined by its differences from the standard Wuhan genome, which are:

G765C A2215C T4608A T4747C C4763G T6006C T6820C A6837C T6976A T6978A T6980C G6986C T6988A C7006A T9316A G9324A T9325A G9648C G9653C -9825T A9826C T9831C T9861G T21656G A24325G G28597C

It is interesting because it is from Wuhan, because it was acquired on the 30th December 2019, because its Divergence is 26, and because nextstrain.org has not bothered to display it.

So, at the very beginning of the Covid-19 epidemic there was, at Wuhan, a strain of Covid-19 that differed from the standard Wuhan genome by 26 mutations. Now that is super-super-fast evolution.

March 16; Confirmed Cases in the Chinese Provinces.

On March 16, the Johns Hopkins University website

https://www.gisaid.org/epiflu-applications/global-cases-covid-19/

reported the following numbers of cases of Covid-19 in each of the Chinese provinces:

67,794 confirmed cases Hubei China (this province includes Wuhan)
1,357 confirmed cases Guangdong China (this province includes Guangzhou)
1,273 confirmed cases Henan China
1,231 confirmed cases Zhejiang China
1,018 confirmed cases Hunan China
990 confirmed cases Anhui China
935 confirmed cases Jiangxi China
760 confirmed cases Shandong China
631 confirmed cases Jiangsu China
576 confirmed cases Chongqing China
539 confirmed cases Sichuan China
482 confirmed cases Heilongjiang China
442 confirmed cases Beijing China (this province includes Beijing)
353 confirmed cases Shanghai China (this province includes Shanghai)
318 confirmed cases Hebei China
296 confirmed cases Fujian China
252 confirmed cases Guangxi China
245 confirmed cases Shaanxi China
174 confirmed cases Yunnan China
168 confirmed cases Hainan China
146 confirmed cases Guizhou China
141 confirmed cases Hong Kong China
136 confirmed cases Tianjin China
133 confirmed cases Shanxi China
132 confirmed cases Gansu China
125 confirmed cases Liaoning China
93 confirmed cases Jilin China
76 confirmed cases Xinjiang China
75 confirmed cases Inner Mongolia China
75 confirmed cases Ningxia China
18 confirmed cases Qinghai China
10 confirmed cases Macau China
1 confirmed case Tibet China

It has been suggested that the Chinese have lied about the low numbers, but this is obviously false; Why would they give real figures for Wuhan, but false figures for other cities? And, anyway, it would be impossible to keep an on-going epidemic secret, especially in Hong Kong.

The complete Train Schedule for trains from Wuhan.

High Speed Train Schedule from Wuhan
DestinationTrainsDurationTicket Fare
1st/2nd Class Seat
Beijing West032 departures from 07:00 to 18:364h12m - 6h2mCNY 832.5/520.5
Shanghai035 departures from 07:27 to 18:553h51m - 6h20mCNY 464.5/289
Hong Kong002 departures at 14:20 and 16:004h38m - 5h2mCNY 1,082.5/678.5
Xi'an North014 departures from 09:17 to 18:053h55m - 5h20mCNY 727.5/454.5
Chengdu016 departures from 06:25 to 14:068h00m - 9h57mCNY 601/375
Chongqing038 departures from 06:25 to 16:125h54m - 7h32mCNY 419/261.5
Guangzhou066 departures from 06:45 to 19:413h45m - 4h51mCNY 708.5/443.5
Shenzhen North026 departures from 07:25 to 17:494h17m - 5h38mCNY 838/538
Futian026 departures from 07:25 to 17:494h17m - 5h38mCNY 838/538
Hangzhou East012 departures from 06:45 to 18:004h29m - 6h24mCNY 454/283
Nanjing059 departures from 06:45 to 20:042h30m - 3h56mCNY 245/153.5
Shenyang004 departures from 07:21 to 09:0510h5m - 12h13mCNY 1,238/767
Zhengzhou085 departures from 07:00 to 21:051h44m - 4h1mCNY 294.5/184
Harbin West001 departure at 07:5512h33mCNY 1,630.5/1,012.5
Changsha South 0103 departures from 06:45 to 21:191h18m - 2h2mCNY 264.5/164.5
Nanning007 departures from 07:06 to 14:496h23m - 7h39mCNY 753/470.5
Xianning058 departures from 06:53 to 21:190h24m - 1h47mCNY 62/37
Shiyan013 departures from 07:30 to 20:00 0 01h57m - 2h56mCNY 225/140
0
Normal Train Timetable from Wuhan
DestinationTrainsDurationTicket Fare
Soft/Hard Sleeper
Beijing27 departures from 01:21 to 23:4210h33m - 18h38mCNY 427.5/279.5
Shanghai06 departures from 18:09 to 22:5410h11m - 18h29mCNY 377.5/247.5
Guangzhou34 departures from 00:50 to 23:5510h36m - 18h26mCNY 443.5/255.5
Xi'an11 departures from 00:21 to 23:3210h34m - 15h15mCNY 357/214
Chengdu10 departures from 01:09 to 23:2610h36m - 22h11mCNY 443.5/272.5
Hangzhou08 departures from 12:43 to 22:548h5m - 15h19mCNY 346/208
Xiamen02 departures at 08:01 and 12:149h27m - 14h50mCNY 405.5/277.5
Changsha52 departures from 00:19 to 23:553h13m - 5h17mCNY 152.5/107.5
Zhengzhou42 departures from 00:37 to 23:424h24m - 9h8mCNY 242/174
Nanchang20 departures from 01:53 to 19:363h2m - 8h41mCNY 194.5/142.5
Yichang East09 departures from 04:34 to 23:262h8m - 6h23mCNY 180.5/134.5
Chongqing North07 departures from 04:34 to 22:367h22m - 18h21mCNY 346/239
Shenzhen07 departures from 05:30 to 21:0512h42m - 18h00mCNY 467.5/279.5
Tianjin08 departures from 01:33 to 22:0811h38m - 20h42mCNY 443.5/299.5
Guiyang05 departures from 00:19 to 23:3815h26m - 17h19mCNY 456.5/299.5
Shiyan09 departures from 00:11 to 23:124h30m - 7h55mCNY 204/136
Kunming03 departures from 00:19 to 23:3822h53m - 28h43mCNY 630/397
Harbin West03 departures from 07:33 to 18:0423h16m - 37h44m 0CNY 749.5/491.5

The Last Update of the Schedule was on Jan 10, 2020.[3]

Interesting videos.

Here is an interesting video from two Californian doctors who recommend that the state's lockdown be lifted immediately. The main speaker mixes up his statistics somewhat, and is inconsistent in his application of them. Also, he appears to be recommending exposure to dangerous pathogens as a way to built up one's immune system, however, he is actually recommending exposure to less virulent strains (which he assumes exist) to do this. Well worth watching (even if they have been heavily pushed by the false opposition (which usually pushes somewhat suspect material)).

https://www.youtube.com/watch?v=36AyI7mwZdk (censored)
https://www.youtube.com/watch?v=xfLVxx_lBLU (censored)
https://www.youtube.com/watch?v=UaTYYk3HxOc (censored)
https://www.youtube.com/watch?v=vJprwe_rWeM (censored) and here 73M.

I recommend the following video by Dr Yeadon (former Pfizer Chief Science Officer). You can watch it here or download it here (640x360 70M).

At one point Dr Yeadon states that the epidemic is over. Now, if the epidemic was a naturally occurring event, he would be correct. However, who knows what evil those spreading the virus may yet have in store for the world.

Here is a video concerning a father and son who both had major reactions to the covid vaccine. It is claimed that both had (the disease) Covid-19 immediately before taking the vaccine. Both developed multiple blood clots. The son, mainly in his brain, and the father, mainly in his lungs. The father permanently lost the use of a quarter of his left lung. The son may eventually recover. More on this below.

Rand Paul has had enough of lockdowns, etc. Rand Paul chooses freedom. See this historic video 13M.

In this video Erin Marie Olszewski is interviewed regarding her time at Elmhurst Hospital in New York. From a review of her book Undercover Epicenter Nurse we have, "Worse, people who had tested negative multiple times for Covid-19 were being labeled as Covid-confirmed and put on Covid-only floors (where they caught the disease). Put on ventilators and drugged up with sedatives, these patients quickly deteriorated; even though they did not have coronavirus when they checked in." Once on ventilators, they invariably died. In the video she calls it murder. You can download the video from here 640x360 96M. The interview was on May 12, 2020.

Erin records a conversation between nurses, and doctors, where the nurses refuse to kill a patient by letting him die when he could have been saved. Apparently, the doctors had been instructed to treat patients as DNR (do not resuscitate) even though they were not DNR. The nurses refused to go along with this. You may ask why the media has refused to investigate her claims. You may ask why the media has refused to even report them.

"Do not attempt resuscitation" orders were also applied to care home patients throughout England, even though neither the patient, nor their family, had signed a "do not resuscitate" document. Doctors who killed patients this way say they were just following orders, and the pressure of the pandemic is used as an excuse for the policy. You may ask why the media has told you nothing about this.

In this video Erin Olszewski is interviewed by thehighwire.com 640x360 38M.

An unexplained correlation between vaccinations and Covid-19 deaths.

This short video graphically shows the correlation. If anyone knows why the vaccinations appear to cause Covid-19 deaths, let me know. I can guess, but I don't know.

References. Part 1.

[1] The Washington Post has said: "All domestic and international flights out of Wuhan were canceled since the city was placed under lockdown last week to prevent the spread of the virus. But the city government says 5 million people left the city before the quarantine came into effect, and some apparently want to return to their homes." and "The mayor of Wuhan said last weekend that 5 million people had left the city before a lockdown was imposed."
[2] https://www.travelchinaguide.com/china-trains/beijing-wuhan.htm "There are over 55 pairs of trains running between Beijing West Railway Station and Wuhan/Hankou Railway Station. Among them, over 30 pairs are bullet trains with the journey time of 4.5-6 hours and another 25 or so pairs are normal ones which take 10-18 hours for the whole way."
[3] https://www.travelchinaguide.com/china-trains/wuhan-schedule.htm
[4] https://www.oag.com/blog/2019-ncov-tracking-down-the-bug
[5] 601 RNA sequences from Iceland have been submitted to GISAID, but nextstrain.org shows only 21 (they used to show more). I looked at 560 of these Icelandic sequences and found 231 to be distinct.
[6] This article states; "Several studies already report that roughly 50% of the infections are asymptomatic (i.e, no symptoms at all), which makes the early detection and isolation of the infected problematic."
[7] This article states; "Notably, the 2019-nCoV strains were less genetically similar to SARS-CoV (about 79%) and MERS-CoV (about 50%)."
[8] The rate is from this article. Note that the rate is not for the whole SARS virus but for just over two thirds of it (the ORF 1ab segment which is about 20,000 bases long). I have since came across this article which gives estimates from 0.80 to 2.38 × 10^-3. The upper estimate here translates to about 70 new varieties fixed in a year, rather than 12. Anyway, 12 or 70, makes little difference to the thrust of the argument above. Nextstrain.org actually gives you a rate estimate of about 25 substitutions per year, but never explains exactly what this means. For more on viral evolution click here.

Note: RNA is like DNA. It is the type of genetic code used by the virus.

Part 2. The Covid-19 Vaccines.

Pfizer-BioNTech and Moderna's Covid-19 mRNA Vaccines.

The general idea of these mRNA vaccines is to have your own cells produce the Covid spike protein. From the site of production (the endoplasmic reticulum) the protein is transported to, and anchored in the cell wall (plasma membrane). There the protein is exposed to the surrounding fluid where it can be investigated by your immune system. Once your immune system recognizes the danger, your body will attempt to block, or kill, everything that expresses the spike protein. In particular, since the Covid virus (SARS-CoV-2) expresses the spike protein, your immune system will attempt to block, or kill it, whenever it finds it.

Obviously, there is much missing from this statement.

What triggers the immune system?

On the viral surface three spike proteins join together to form a single structure called a spike. There are about 26 of these spikes scattered over the surface of the virus (where they are anchored in the viral membrane). Now the vaccine leads to such spikes on the surface of your cells (where they are anchored in the plasma membrane). If these spikes just lay about on the cell surface, then why would this trigger your immune system? If they do nothing, how will your immune system recognize them as dangerous?

Generally, cells have to die, and unexpectedly, before the their debris is sifted by the immune system to find what killed them. If your body finds something unusual among the debris it invites further investigation by specialist cells that determine whether this unusual thing is to be flagged as dangerous, and whether, in the future, anything expressing this unusual thing is to be killed on sight. Thus, to trigger the immune system, the spikes on the cell surface would have to kill a few of your cells, and a few spikes, or bits of them, would have to be found among the debris at the crime scene, so that "what did it" can be established.

Now these vaccine spikes are created alone. They have no help from the sibling proteins produced when the Covid virus infects a cell. So can these spikes, completely separated from the rest of the virus, trigger your immune system? Can they kill anything? We read;

Severe cases of Covid-19 are associated with extensive lung damage and the presence of infected multinucleated syncytial pneumocytes. The viral and cellular mechanisms regulating the formation of these syncytia are not well understood. Here, we show that SARS-CoV-2-infected cells express the Spike protein (S) at their surface and fuse with ACE2-positive neighboring cells. Expression of the Spike protein without any other viral proteins triggers syncytia formation. [1]

Like other fusion proteins that are active pH independently, S protein mediates not only fusion between the viral and the cellular membranes during particle entry but also fusion of infected cells with uninfected cells. This process is mediated by newly synthesized S protein accumulating at the cell surface. The resulting syncytia are giant cells containing at least three, often many more nuclei. Cell-cell fusion is used by viruses such as human immunodeficiency virus (HIV), measles virus (MV), or herpes virus to spread in a particle-independent way. The resulting syncytia are documented as pathological consequence detectable in various tissues such as the lung (measles virus), skin (herpes virus), or lymphoid tissues (HIV). In the brain, cell-to-cell transmission via hyperfusogenic F proteins (the measles spike protein) constitutes a hallmark of MV-caused encephalitis as a fatal consequence of acute MV infections manifesting years later (from one day to 15 years). [2]

Note that the spike protein is often simply called the S protein. Syncytia are large multi-nucleate cells formed from the fusion of many cells. That the spike proteins of many coronaviruses, by themselves, can induce syncytia, has been known for decades. We have this from a 2003 review of the molecular biology of coronaviruses:

During infection by some corona-viruses a fraction of the S protein that has not been assembled into virions ultimately reaches the plasma membrane. At the cell surface S protein can cause the fusion of an infected cell with adjacent, uninfected cells, leading to the formation of large, multinucleate syncytia. This enables the spread of infection independent of the action of extracellular virus, thereby providing some measure of escape from immune surveillance. Expression of S without any other viral proteins triggers syncytia formation. [3]

Wild-type Covid spikes have the ability to reach out, grab a neighboring ACE2-positive cell, and cause both cells to merge. This can happen multiple times so that one ends up with large non-functional cells (syncytia) which die. If this happens, then all the individual cells are seen to die unexpectedly, and spikes, and bits of spike, end up among the debris. This shows that the expression of wild-type Covid spikes, by themselves, should trigger an immune response. That is, if a vaccine induces wild-type Covid spikes on your cell's surfaces, then this will trigger an immune response.

Even though the syncytia formed here are non-functional, there are fully-functional syncytia, e.g., in muscles, and the syncytium layer surrounding the placenta.

In vaccine development, the antigen you are trying to invoke an immune response to, often does not have the innate killing power of the spike protein. For example, you might try to invoke an immune response to a small piece of the spike protein known as the Receptor Binding Domain (RBD), which by itself cannot kill cells. In this case you need to add another chemical, called an adjuvant, to kill a few cells, and frame the antigen (the RBD) for the crime. If successful the immune system is triggered, and the antigen targeted for destruction.

To see that the expression of the complete spike protein on the surface of the cell is the "Holy Grail" of Covid-19 vaccine design, we have this:

Vaccine development against the SARS-CoV-2 virus focuses on the principal target of the neutralizing immune response, the spike (S) glycoprotein. Adenovirus-vectored vaccines offer an effective platform for the delivery of viral antigen, but it is important for the generation of neutralizing antibodies that they produce appropriately processed and assembled viral antigen that mimics that observed on the SARS-CoV-2 virus. Here, we describe the structure, conformation and glycosylation of the S protein derived from the adenovirus-vectored ChAdOx1 nCoV-19/AZD1222 vaccine. We demonstrate native-like post-translational processing and assembly, and reveal the expression of S proteins on the surface of cells adopting the trimeric pre-fusion conformation. The data presented here confirms the use of ChAdOx1 adenovirus vectors as a leading platform technology for SARS-CoV-2 vaccines. [4]

It is alarming that the aim of mRNA vaccines is to have the spike protein expressed on the surface of your cells, as this is appears quite dangerous.

How dangerous is the spike protein?

It has been realized that the coronavirus S protein is a type I viral fusion protein with functional similarities to the fusion proteins of phylogenetically distant RNA viruses such as influenza virus, HIV, and Ebola virus. [3]

That the covid virus spike proteins are related to those of the influenza, HIV, Ebola, and SARS-CoV viruses, definitely suggests that they could be quite dangerous. We have:

The data reveal a strong membrane fusion activity of S protein and demonstrate syncytia formation even at undetectable levels of the S protein. [2]

The wild-type Covid spike protein is so strongly fusogenic, that it is capable of producing syncytia even when present in undetectable quantities. These syncytia are strongly associated with severe cases of Covid-19.

Persistence of viral RNA, pneumocyte syncytia and thrombosis are hallmarks of advanced Covid-19 pathology. [5]

In summary, Covid-19 is a unique interstitial pneumonia with extensive lung thrombosis, long-term persistence of viral replication in pneumocytes and endothelial cells, along with the presence of infected cellular syncytia in the lung. We propose that several of the Covid-19 disease features are due to the persistence of virus-infected cells in the lungs of the infected individuals for the duration of the disease. [5]

This pronounced ability to fuse cells is typical of coronaviruses in general. A particularly virulent coronavirus, the JHM strain of mouse hepatitis virus, is associated with large syncytia in the brains of mice.

The S protein of the highly virulent coronavirus, mouse hepatitis virus (MHV) strain 4 (JHM), has been shown to exist in a particularly metastable configuration. This results in a hair-trigger spike so highly fusogenic that it can mediate fusion between infected cells and (neighboring) cells lacking receptors, thereby leading to more extensive neuropathogenesis than occurs with other MHV strains. [3]

Natural questions are: Can the Covid virus infect human brains? And, if so, can the spike protein alone do similar damage? The answer to the first question is yes.

Together, these results are the first to show the direct impact that the SARS-CoV-2 spike protein could have on brain endothelial cells; thereby offering a plausible explanation for the neurological consequences seen in Covid-19 patients. [6]

Is the spike protein always dangerous?

By itself, the Covid spike protein should be less dangerous than the virus. For many the Covid virus causes little harm, but for others it is fatal. So for many, the Covid spike protein, by itself, will cause little harm, but for others it may prove fatal. So why not cripple it in some way, while retaining its original conformation? This appears to be what Pfizer-BioNTech and Moderna have done, although they do not claim this.

The Pfizer-BioNTech and Moderna mRNA vaccines produce a spike protein (denoted S-2P) with two amino acid changes from the wild-type. The two changes, K986P and V987P, are to stabilize the pre-fusion form of the protein. This stabilization is necessary to make sure that antibodies are made against the pre-fusion, and not the post-fusion form. A 1967 trial of an RSV (Respiratory Syncytial Virus) vaccine was a disaster as the vaccine induced antibodies that bound to the post-fusion form of the RSV-spike protein, but did not prevent infection, which lead to inflammation, clogged airways, and more severe disease than with no vaccine at all. [7][8]

The idea of stabilizing the pre-fusion form comes from previous work on HIV, RSV, SARS and MERS. The equivalent changes, V1060P and L1061P, that stabilize the pre-fusion form of the MERS spike protein are claimed to significantly impair cell fusion. So, it is probable that the changes, K986P and V987P, do likewise for the Covid spike protein.

The phrase "stabilizing the pre-fusion form" implies that the pre-fusion form can still change to the post-fusion form, that is, that the Covid spike-2P protein can still cause cell fusion, but probably not to the same extent. One guesses that syncytia are still formed, but they are fewer and smaller. Still, it seems that enough cells die to trigger an immune response without an adjuvant.

We have this regarding the MERS S-2P protein:

The introduction of two consecutive proline substitutions at the beginning of the central helix (our 2P design) presents a general approach to produce soluble prefusion coronavirus S ectodomains and overcomes the first hurdle in subunit vaccine development. Due to restricted backbone torsion angles, proline substitution can disfavor the refolding of the linker between the central helix and HR1, which for class I fusion proteins is a key step in the transition to the postfusion conformation. The rigidity of the helix-loop-helix afforded by the prolines impairs or (perhaps) abolishes the membrane fusion activity of the S protein, as evidenced in Fig. 2A. [9]

Actually, membrane fusion is not abolished by the 2P changes, but by this change, that was hiding in the small print:

The S1/S2 furin-recognition site 748-RSVR-751 was mutated to ASVG to produce a single-chain S0 protein. [9]

This mutates the MERS-spike multibasic cleavage site (furin-recognition site). Since it appears that the mutation of the multibasic cleavage site, and the 2P changes, make the vaccine much less dangerous, it is a worry that many vaccines do not include these changes. We have;

The ChAdOx-based vaccine candidate developed by AstraZeneca, as well as the CanSino- and Gamaleya-vectored candidates, use a wild-type version of the spike protein. The same is of course true for the inactivated vaccines produced by Sinovac and Sinopharm. Moderna's and Pfizer's mRNA vaccines are based on a spike construct that includes the PP mutations but features a wild-type cleavage site. [21]

Why is Covid-19 more dangerous to some than others?

The present studies suggest that coinfection of SARS-CoV with some other non- or low-pathogenic respiratory agents, such as Chlamydia, mycoplasma, or bacteria, results in severe lung disease, which is attributed to the proteases produced by the infection with those non-SARS-CoV agents, as has been shown by the enhancement of respiratory diseases caused by influenza virus coinfected with non-pathogenic bacteria. Studies are in progress to see whether coinfection exacerbates pneumonia in mice infected with SARS-CoV. [10]

The above statement concerns SARS-CoV-1. This suggests it may be true for Covid-19. So, if you are unlucky enough to have one of these respiratory infections, when struck by Covid-19, you might die. This would be because these other infections induce the production of certain surface proteases which prime the Covid spike protein, and enable it to form syncytia, that is fuse cells, that is, turn some part of your lungs to mush. This would also probably be true for vaccine spikes.

So, is this also true for covid-19? Little research seems to have been done. We do have:

As with some other RNA viruses, co-infection or activation of latent bacterial infections along with pre-existing health conditions in Covid-19 disease may be important in determining a fatal disease course.... Although preliminary, Mycoplasma pneumoniae has been identified in Covid-19 disease, and the severity of some signs and symptoms in progressive Covid-19 patients could be due, in part, to Mycoplasma or other bacterial infections. [13]

Altogether, our analysis described the distribution of SARS-CoV-2-infected cells in patient's BAL and revealed the presence of a viral co-infection by the human metapneumovirus that dampens the immune activation of the monocyte compartment in the infected patient. Further large-scale analyses of mild versus severe patients need to be conducted to better understand if the co-infection is correlated or even causative in SARS-CoV-2 pathology. [14]

As noted above: Studies are in progress to see whether coinfection exacerbates pneumonia in mice infected with SARS-CoV. [10]

I have found one of these studies. In it the authors state that co-infection of mice with SARS-CoV, and Pasteurella pneumotropica (a low-pathogenic bacterium) induces severe pneumonia resembling that found in human SARS cases (> 35% mortality rate). Mice infected with either pathogen alone, do not develop severe disease. [16]

These studies were initiated due to the previous discovery that elastase, like TMPRSS2, enables SARS-CoV to enter directly from the cell surface, and that this direct entry likely leads to serious disease.[17][10] Since a Pasteurella pneumotropica infection is known to elicit elastase production in the lungs, it was predicted that co-infection with SARS-CoV would lead to severe pneumonia, which it did. This is important, as neutrophils, a type of immune cell, secrete elastase into the lungs during infection. This suggests that coinfection of SARS-CoV with any respiratory agent that causes inflammation is likely to lead to more serious disease.

So, what about Covid-19? Astonishingly, the research into Covid-19, and elastase, seems not to have been done. We do have:

Neutrophil elastase was an independent predictor of Covid-19 lung damage. [18]

This says that the presence of elastase is highly correlated with severe lung damage. Given this, how is it possible that necessary studies have not been done? The same article states;

Many arguments suggest that neutrophils could play a prominent role in Covid-19. However, the role of key components of neutrophil innate immunity in severe forms of Covid-19 has (received) insufficient attention. [18]

And, what about vaccine spikes? The research has not been done. All one can say is, if you have any condition that leads to inflammation of your lungs, you should probably not receive the vaccine, as it will likely lead to greater cell death, due to increased formation of syncytia in your lungs.

Here is a video concerning a father and son who both had major reactions to the covid vaccine. It is claimed that both had (the disease) Covid-19 immediately before taking the vaccine. Both developed multiple blood clots. The son, mainly in his brain, and the father, mainly in his lungs. The father permanently lost the use of a quarter of his left lung. The son may eventually recover. The video can be found here or here.

Leaving aside the inexplicable lack of research, one wonders about the cytokine storm that is often blamed for the observed lung damage. Does severe lung damage cause a heightened immune response that results in a cytokine storm, or does a faulty immune response cause a cytokine storm that results in severe lung damage? Since it is obvious that severe lung damage will cause a cytokine storm, what is the evidence, that the observed cytokine storm actually causes the lung damage.

In order to proceed we need to develop a little background knowledge.

How does the Covid-19 virus get into your cells?

The Covid-19 virus can enter a cell in two different ways, by membrane fusion and endocytosis. The following diagrams illustrate this.

Image

In membrane fusion the Covid virus spike protein attaches to an ACE2 receptor of the target cell, then, if present on the target cell, a TMPRSS2 receptor cleaves the S2 fusion sub-protein. This primes the spike protein for fusion. On fusion, the viral membrane and cell wall merge, which dumps the viral RNA into the cytoplasm. In the absence of TMPRSS2 receptors, the virus travels by the endocytosis pathway. That is, once the virus has attached to an ACE2 receptor, it is wrapped in a membrane and bought inside the cell. The membrane plus engulfed material is called an endosome. Inside the endosome are various proteins that cutup other proteins. One of these, cathepsin L, primes the spike protein for fusion. On fusion, the viral and endosome membranes merge. Again, this results in the viral RNA being dumped into the cytoplasm.

It has been established that the Covid virus mainly uses membrane fusion to enter cells. As you can see from the diagram, membrane fusion leaves copies of the spike protein on the cell surface, although this fact has been obscured by having the spikes of the rightmost viral particle, drawn differently. Here is another diagram sketching Covid-19 virus replication:

Image

Again, the membrane fusion pathway has been obscured.

Why do the vaccines work at all?

I've come across a problem that I have not been able to resolve. Basically, the problem is;

It is believed that a Covid infection begins in the epithelial cells of the respiratory tract. Nasotracheal epithelial cells, and lung alveolar epithelial cells are known to carry both ACE2 and TMPRSS2 receptors. ACE2 has been found to colocalize with TMPRSS2 in alveolar epithelial type II cells, so that after binding, the virus can immediately break into the cell. So, we expect to see rapid expansion of infected sites due to cell-cell and virus-cell fusion.

We also know that the antibodies, etc, created by vaccination, are in the blood and interstitial fluid, which is separated from the action. So, how do the antibodies, etc, stop the infection? It seems that by the time they find out about the infection it will be too late.

So, why would the covid vaccines work, at all?

Image

In the diagram the gap between the alveolus and capillary (the interstitium) is wider than it should be.

It is believed that a measles infection begins in the epithelial cells of the respiratory tract, and can infect alveolar epithelial cells resulting in pneumonia, as can Covid-19. We also know that there is an effective measles vaccine that produces antibodies, etc, in the blood and interstitial fluid. This is separated from the scene of the action (within the alveoli) by the epithelial basement membranes, yet this vaccine works. So, how does it work, and what might this tell us about Covid-19?

The paper "Cell-to-Cell Contact and Nectin-4 Govern Spread of Measles Virus from Primary Human Myeloid Cells to Primary Human Airway Epithelial Cells," may provide some answers. It says:

For many years, measles virus was thought to enter through the apical surface (the surface in contact with the air) of airway epithelial cells, a misconception based on studies performed with polarized immortalized cell lines. Using well-differentiated primary cultures of airway epithelial cells from human donors, we demonstrated that measles virus has a clear preference for basolateral (the surface anchored to the body) entry. [15]

So, the measles virus may not infect the alveoli from the air, after all. We also have:

Measles is a highly contagious, acute viral illness. Immune cells within the airways are likely first targets of infection, and these cells traffic measles virus to lymph nodes for amplification and subsequent systemic dissemination. Infected immune cells are thought to return the virus to the airways. [15]

So, the measles virus first infects cells in the airways, including various immune cells. These infected immune cells spread the virus throughout the body. In particular, they infect the alveolar epithelial cells of the lungs via their basolateral surfaces. So, strange as it may seem, the infection spreads to the alveolar epithelial cells from within the body, not from the air, as one has been told. This would certainly explain why the measles vaccine works.

Perhaps something like this happens with Covid-19. There is a lot of speculation here. The first thing that would need to be checked, is; Can the Covid virus infect immune cells? The answer to this appears to be yes. I have found a paper that states;

SARS-CoV-2 exhibits a polarity of infection in airway epithelium only from the apical membrane; [19]

I am suspicious of this (and other similar reports). Why would the apical membrane (the surface of the cell exposed to the air) have ACE2 receptors? Why would the apical membrane have any receptors at all? What use would they be? And, even if there were a few, wouldn't the surfactant layer prevent them from working? If the world made any sense, then the receptors would be in the basolateral membrane where they would be used to communicate with cells in the rest of the body. The only point of having receptors in the apical membrane would be to allow airborne viruses to break into your body.

Remember, a similar result was claimed for the measles virus.

These results also support the conclusion that measles virus entry occurs selectively at the apical plasma membrane. [20]

However, this has been shown to be false, as mentioned above.

Do mRNA vaccine nanoparticles get into your brain?

So where exactly do the mRNA vaccine nanoparticles go after they have been injected into your arm?

The 2017 paper Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses, [30] tells you where the nanoparticles end up when administered to mice. It tells you the concentration of nanoparticles in the various tissues, which indicates how much spike protein will be produced, which indicates how much damage the spike protein will do to these tissues. The numbers below are from Table 1 of the paper. They represent the maximum concentration of nanoparticles in the various tissues (ng/ml) after having received the jab.

Bone Marrow 3.35
Brain 0.43
Cecum 0.89
Colon 1.11
Close Lymph Nodes 2120.00
Distant Lymph Nodes 177.00
Heart 0.80
Ileum 3.54
Jejunum 0.33
Kidney 1.31
Liver 47.20
Lung 1.82
Muscle (Injection Site) 5680.00
Ovaries ????
Plasma 5.47
Rectum 1.03
Spleen 86.90
Stomach 0.63
Testes 2.37

The study uses Moderna's lipid nanoparticles.

The fact that the payload of these nanoparticles is RNA from influenza, and not covid-19, will make little difference to the results, as (by design) the mRNA is buried in the nanoparticle, below a lipid layer. The mRNA only becomes exposed after a nanoparticle merges with one of your cells, and dumps its mRNA into that cell. Note that the lymph nodes close to the injection site receive an extremely high dose of nanoparticles. This means that the generated spike protein will do significant damage to them. What are the long term effects of this damage?

This study investigated both male, and female mice, but only reported on the male mice. This lends credence to the rumors that a dangerously large quantity of the nanoparticles ends up in the ovaries. One leaked report, supposedly from Pfizer, puts the concentration of nanoparticles in the ovaries at about half of that found in the spleen, which is a lot. This has caused much speculation. Is the vaccine designed to cause female sterility? However, such "leaked reports" are often "released" specifically to mislead people. But, who knows? At this point nothing would surprise me.

Vesicular stomatitis virus vaccines.

The vesicular stomatitis virus (VSV) mainly infects animals, but can produce a flu-like illness in humans. VSV has become a favorite for vaccine development as its genome is relatively simple, well understood, and easy to manipulate. Vaccines based on VSV are being developed for influenza, HIV, SARS, MERS, Ebola, Marburg, and Lassa fever. The Ebola vaccine, Ervebo, has been trialled and approved for humans. [32-39]

An important feature of the virus is that the native spike protein, called G, can be easily replaced by foreign spike proteins. Now, if you wished to develop a vaccine against SARS-CoV-2 you would replace the RNA-code for G by the RNA-code for the SARS-CoV-2 spike protein (in the vesicular stomatitis virus genome). Then, after a certain amount of routine tweaking you would bring the lifeless RNA to life. The virus so formed will have a vesicular stomatitis virus body (called a backbone or shell) with SARS-CoV-2 spikes protruding from it. This chimeric virus will be new to nature, and if well-designed will be able to reproduce itself (replication-competent). Such viruses can also be engineered to undergo only one round of infection (replication-deficient).

As the only SARS-CoV-2 part of this new virus is the spike protein, it is likely safer than the SARS-CoV-2 virus itself. If this new virus proves to be relatively safe, then it can be administered as a vaccine. In its action this virus is much like the vaccines of Pfizer and Moderna, the main difference being that the delivery vehicle of one is a nanoparticle, and of the other is a hybrid virus. Both methods deliver the genetic code into the cytoplasm where the cellular machinery will crank out SARS-CoV-2 spike protein. Both allow the SARS-CoV-2 spike protein to leak to the cell surface where it invokes an immune reaction. Apparently, this leakage is due to a sub-optimal endoplasmic reticulum retrieval signal (-KxHxx-COOH) in the spike protein's cytoplasmic tail.[27] The hybrid virus will be much more selective in the type of cells it infects as infection is controlled by the SARS-CoV-2 spike protein. Thus it will mainly infect cells expressing ACE2, whereas, nanoparticles will infect any cells they come across.

Of course, this vaccine production strategy has already been carried out for SARS-CoV-2, and a number of vaccine candidates have been engineered. In 2020 Merck began clinical trials of two VSV-type vaccines targeting SARS-CoV-2, but abandoned them in January 2021.

As the hybrid virus VSV-SARS-CoV-2 resulting from swapping-in the wild-type SARS-CoV-2 spike protein was found to replicate poorly, and was pathogenic (significant syncytia formation) the virus had to be serially passaged (cultured in cells for a number of generations) to look for mutations that replicated better, and were less dangerous.

In [31] the researchers passaged the VSV-SARS-CoV-2 virus until two mutations of the spike protein became dominant. One, R685G, was a mutation of the multibasic S1/S2 cleavage site which left the site non-functional. As is always the case, the loss of function of the multibasic S1/S2 cleavage site leads to a virus that out-competes, and in short time dominates, its parental variety. (Incidentally, this sort of thing is evidence that most of these multibasic cleavage sites have been genetically engineered.) The other was a mutation introducing a stop codon at position 1250, leading to the truncation of 24 amino acids at the cytoplasmic tail. This truncation removes most, if not all, of the trafficking signals for the spike protein. Thus more spike protein ends up on the plasma membrane where it is incorporated into new virus particles (VSV-like particles are assembled at the plasma membrane) and if the multibasic S1/S2 cleavage site is still functional, this will also significantly increase syncytia formation. New virus with the R685G mutation, and 21-amino-acid deletion was chosen as their vaccine candidate.

Spike swapping in VSV has long been used to study viral spike proteins. It has become routine and in the paper "A Multibasic Cleavage Site in the Spike Protein of SARS-CoV-2 Is Essential for Infection of Human Lung Cells," [23] they produce six spike swapped viruses all of which could have become vaccine candidates.

In this paper the researchers create four mutant SARS-CoV-2 spike proteins. They are;
1) SARS-2-S(RaTG) which has the SARS-CoV-2 S1/S2 cleavage site replaced by the bat RaTG13 S1/S2 cleavage site;
2) SARS-2-S(SARS) which has the SARS-CoV-2 S1/S2 cleavage site replaced by the SARS-CoV S1/S2 cleavage site;
3) SARS-2-S(delta) has all the basic amino acids in the S1/S2 cleavage site removed or replaced; and
4) SARS-2-S(opt) which has extra basic amino acids (arginine and lysine) to make the cleavage site super-basic.

They also create two mutant SARS-CoV spike proteins. They are;
1) SARS-S(RaTG) which has the SARS-CoV S1/S2 cleavage site replaced by the bat RaTG13 S1/S2 cleavage site; and
2) SARS-S(SARS-2) which has the SARS-CoV S1/S2 cleavage site replaced by the SARS-CoV-2 S1/S2 cleavage site.

They then incorporate each of these foreign spike proteins into a VSV backbone, creating six different vaccine candidates/viruses. They also introduce the three wild-type spike proteins of SARS-CoV, SARS-CoV-2, and MERS, into a VSV backbone, creating three more vaccine candidates/viruses. Finally they simply produce spikeless VSV particles (i.e., the spike protein G is deleted with no replacement). They do this to investigate the pathology of the nine different spike proteins once expressed in your cells. The spikeless VSV particles (empty vector) serve as a control. Having created these hybrid viruses they then infect cells with them and record the results.

The researchers chose Vero E6 cells (ATCC Cat# CRL-1586) a cell line from monkeys that expresses ACE2 and is commonly used to model human cells. Generally, ACE2 expression in human cells is low.[28][29] They prepared;

1) Vero E6 cells without any added protease/enzymes,
2) Vero E6 cells with extra-cellular trypsin, and
3) Vero E6 cells expressing TMPRSS2.

Each of the nine VSV hybrids, as well as the spikeless particles, were used to infect each of the three cell cultures. This gave thirty cultures to report on. The results are shown as a matrix of small photos (shown below) of the cultures 48 hours after infection. These photos show the results of having the various spike proteins expressed on the surface of the Vero E6 cells. They indicate the level of damage done by the various spike proteins to the ACE2 expressing cells in your body.

Image

For example, the photo in the (1,5) position shows the damage done to Vero E6 cells by being vaccinated with the VSV-SARS-CoV-2 hybrid. It indicates the damage done to your ACE2 expressing cells by having your cells express wild-type SARS-CoV-2 spike protein. It also indicates the damage done by vaccination with any vaccine that uses wild-type SARS-CoV-2 spike protein to invoke an immune reaction. This would include the current covid vaccines as they express wild-type, or almost wild-type, spike protein. As syncytia formation is evident, there will be some tissue damage, but you should recover. The level of adverse side-effects will be high.

The photo in the (3,5) position indicates the damage done to cells expressing both ACE2, and TMPRSS2 by wild-type SARS-CoV-2 spike protein. ACE2 and TMPRSS2 are co-expressed in a small percentage of cells in your lungs, nose, cornea, esophagus, ileum, colon, gallbladder and bile duct. Here, syncytia formation is widespread. This is indicative of significant tissue damage in your lungs, etc. Fortunately, the percentage of nanoparticles reaching your lungs is low, however, it is much higher for your lymph nodes, spleen and liver. [30 Table 1]

The photo in the (3,9) position indicates the damage done by the MERS spike protein to your cells expressing TMPRSS2. Note that MERS uses DPP4, and not ACE2, for viral entry. This illustrates how dangerous MERS is. It can turn your lungs to mush.

A very dangerous Covid-19 virus variant.

The SARS-2-S(opt) hybrid virus looks amazingly dangerous. The relevant photos are (1,1) (1,2) and (1,3). Here, syncytia formation is extreme. Here the cleavage motif at the S1/S2 cleavage site has been destabilized by adding extra arginine (R) and lysine (K) units. In other coronaviruses this causes the spike proteins to be so unstable that they are able to fuse neighboring cells without the need of any receptor. In case you are wondering, this is an example of "gain of function" research.

Fortunately, such heavily multibasic motifs can never establish themselves naturally. Such motifs cause the spike protein to be quite unstable, and thus very dangerous. However, being so unstable the spike fires prematurely, and also participates in cell-cell fusion, rather than being incorporated into new virus. This means that viruses with such motifs replicate poorly, and are no match for the parental-type without such motifs. Viruses having such spikes are seen to be strongly selected against. Thus whenever a mutation occurs that leads to a heavily multibasic cleavage site you have only one non-competitive virus in a sea of viruses that out compete it. Thus it, and its meager offspring, die out by natural selection. This is illustrated by the experiments carried out by the same researchers where they found a nine-fold reduction in the ability of the SARS-2-S(opt) virus to infect TMPRSS2- Vero cells and a seven-fold reduction in its ability to infect human TMPRSS2+ Calu-3 cells. See [23 Figure 2E]. Many other papers have noted similar reductions in fitness for viruses with heavily multibasic cleavage motifs. In fact, this is even true for SARS-CoV-2 with its sub-optimal furin multibasic cleavage site. See, for example, [31][25].

How does the Covid-19 virus reproduce?

How is the vaccine mRNA delivered into your cells?

Are lipid nanoparticles safe?

How do your cells produce the spike protein?

How does the spike protein reach the cell surface?

The first dose primes your body to kill. The second dose labels cells to be killed. Is this good?

What is antibody-dependent enhancement?

Conclusions.

Expression of the spike protein (without any other viral proteins) triggers syncytia formation.

All the currently available Covid vaccines rely on expression of the spike protein to induce an immune response.

Therefore all the currently available Covid vaccines are potentially dangerous.


I would be very wary of all Covid vaccines, especially those where the spike protein retains the multibasic cleavage site, and does not have the 2P changes. All vaccines that use the wild-type spike protein should look at incorporating the 2P changes (K986P and V987P). Removal, or mutation, of the multibasic S1/S2 cleavage site is a must. [21][25] We have:

mutation of the multibasic site completely prevents syncytia formation. [22]

Moreover, deletion of the multibasic motif resulted in a spike protein that was no longer able to induce syncytium formation even in the presence of trypsin or TMPRSS2. [23]

Novavax has such a vaccine candidate. [24]

At this point I would decline the vaccine. I would take a "wait and see" approach. Experimental evidence suggests the vaccines will kill a large number (billions) of your cells. Clinical evidence shows that most will recover from this without much difficulty. However, we also know that the number of adverse events is much, much greater than for the flu-vaccines. Since Covid is not that dangerous to most people, those not at risk should not be vaccinated until a truly safe vaccine is developed.

A number of medical experts say that the current crop of covid vaccines should not be on the market, at all.

A review article on ivermectin concludes that: Moderate-certainty evidence finds that large reductions in Covid-19 deaths are possible using ivermectin. [43] Dr Pierre Kory's testimony before the U.S. Senate, makes a powerful statement as to the effectiveness of ivermectin in treating Covid-19. You can find a few testimonials (from 2020) as to the potency of ivermectin in treating severe covid-19, here. Those that blocked the use of ivermectin and hydroxychloroquine should be shot. The latest ivermectin trial shows a 90% reduction in mortality if used as a prophylactic.

Both hydroxychloroquine and ivermectin have been conclusively shown to be of great benefit to covid-19 patients. A meta-study of 302 hydroxychloroquine trials can be found here. A meta-study of 71 ivermectin trials can be found here.

One of the benefits of "waiting and seeing", rather than being guinea-pigs in a massive experiment run by evil people, is that you get to find out that the vaccine does not work all that well. It also causes many severe adverse events, and you really should not be vaccinated until a truly safe vaccine is developed. That it isn't working well is shown by the talk of "breakthrough cases". For example;

The Massachusetts Department of Public Health tracked a cumulative 9,969 confirmed Covid-19 infections among those fully vaccinated in Massachusetts to date and 106 of those have died. From here.

(By the end of July, 2021) at least 125,000 fully vaccinated Americans have tested positive for Covid and 1,400 of those have died, according to data collected by NBC News. The data is from 38 states; 12 states provided no, or incomplete information, and were not included in the survey.

Of course, the liars spin the vaccines as a great success, despite the breakthrough case deaths.

Given what is now known, no one should be given this vaccine:

1) It doesn't work as claimed.
2) The breakthrough cases are probably ADE (antibody dependent enhancement) showing itself. This means that the vaccine actually increases the risk of catching Covid-19, and can increase the severity of the disease when you encounter the disease in the future.
3) With effective cures available, the disease is simply not dangerous enough to warrant the risk that comes with the vaccine. The disease has been made to look very dangerous by having it deliberately spread in nursing/care homes, and hospitals, where having Covid-19 was truly dangerous.

If you are still contemplating the vaccine, watch this video first. In it an eminently qualified doctor warns of the very real dangers of the covid vaccines. Here is another interview with the same doctor. And another (about half way through).

On October 2, 2021, Dr Peter McCullough spoke at the 78th Annual Meeting of the "Association of American Physicians and Surgeons". Here is a (must watch) video where he shows that the covid-19 vaccines have been proven unsafe, and should have been withdrawn back in February 2021, when only 27 million Americans had been vaccinated. 98M. You can watch a larger version of the video here.

Recently, Dr Peter McCullough appeared on an episode of The Joe Rogan Experience and discussed a range of topics concerning the Covid-19 pandemic. You can download the video from here. 259 M.

This video, from May 2021, is one of Peter McCullough's best interviews. 133M. Here is part one of an August 2021 interview titled "This Interview Could Save Your Life." 64M. Here is part two. 116M.

Dr McCullough certainly gets around. In this video he discuses Covid-19 with Alex Jones. 83M. And here is his March 10, 2021, testimony before the Texas-Senate-HHS-Committee. 25M.

Robert F Kennedy's book The Real Anthony Fauci; Bill Gates Big Pharma and the Global war on Democracy and Public Health. The first couple of hundred pages summarize (one part of) the Covid fraud, and Fauci's leading role in it.

Scott Atlas served as a member of the White House Coronavirus Task Force and Special Advisor to President Trump. In his book he relates an insider's view of events at the White House.

This is just my two pennies worth. Make of it what you will.

References. Part 2.

[1] Syncytia formation by SARS-CoV-2-infected cells.
[2] Quantitative assays reveal cell fusion at minimal levels of SARS-CoV-2 spike protein and fusion from without.
[3] The molecular biology of Coronaviruses.
[4] Native-like SARS-CoV-2 spike glycoprotein expressed by ChAdOx1 nCoV-19/AZD1222 vaccine.
[5] Persistence of viral RNA, pneumocyte syncytia and thrombosis are hallmarks of advanced Covid-19 pathology.
[6] The SARS-CoV-2 spike protein alters barrier function in 2D static and 3D microfluidic in-vitro models of the human blood–brain barrier.
[7] A highly stable prefusion RSV F vaccine derived from structural analysis of the fusion mechanism.
[8] Brief History and Characterization of Enhanced Respiratory Syncytial Virus Disease.
[9] Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen.
[10] Protease-mediated enhancement of severe acute respiratory syndrome coronavirus infection.
[11] Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses.
[12] Neuroinvasion of SARS-CoV-2 in human and mouse brain.
[13] COVID-19 Coronavirus: Is Infection along with Mycoplasma or Other Bacteria Linked to Progression to a Lethal Outcome?
[14] Host-Viral Infection Maps Reveal Signatures of Severe COVID-19 Patients.
[15] Cell-to-Cell Contact and Nectin-4 Govern Spread of Measles Virus from Primary Human Myeloid Cells to Primary Human Airway Epithelial Cells.
[16] Co-infection of respiratory bacterium with severe acute respiratory syndrome coronavirus induces an exacerbated pneumonia in mice.
[17] Entry from the Cell Surface of Severe Acute Respiratory Syndrome Coronavirus with Cleaved S Protein as Revealed by Pseudotype Virus Bearing Cleaved S Protein.
[18] Elastase and exacerbation of neutrophil innate immunity are involved in multi-visceral manifestations of Covid-19.
[19] Long-Term Modeling of SARS-CoV-2 Infection of In Vitro Cultured Polarized Human Airway Epithelium.
[20] Entry and Release of Measles Virus Are Polarized in Epithelial Cells.
[21] Introduction of Two Prolines and Removal of the Polybasic Cleavage Site Lead to Higher Efficacy of a Recombinant Spike-Based SARS-CoV-2 Vaccine in the Mouse Model
[22] Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion.
[23] A Multibasic Cleavage Site in the Spike Protein of SARS-CoV-2 Is Essential for Infection of Human Lung Cells.
[24] Structural analysis of full-length SARS-CoV-2 spike protein from an advanced vaccine candidate.
[25] Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis.
[27] Sequences in the cytoplasmic tail of SARS-CoV-2 spike facilitate syncytia formation.
[28] SARS-CoV-2 entry factors are highly expressed in nasal epithelial cells together with innate immune genes.
[29] The scRNA-seq expression profiling of the receptor ACE2 and the cellular protease TMPRSS2 reveals human organs susceptible to COVID-19 infection.
[30] Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses.
[31] A single dose of recombinant VSV-ΔG-spike vaccine provides protection against SARS-CoV-2 challenge.
[32] Live attenuated recombinant vaccine protects nonhuman primates against Ebola and Marburg viruses.
[33] A system for functional analysis of Ebola virus glycoprotein.
[34] Properties of Replication-Competent Vesicular Stomatitis Virus Vectors Expressing Glycoproteins of Filoviruses and Arenaviruses.
[35] Recombinant vesicular stomatitis viruses from DNA.
[36] Vaccination with Recombinant RNA Replicon Particles Protects Chickens from H5N1 Highly Pathogenic Avian Influenza Virus.
[37] Development of an HIV vaccine using a vesicular stomatitis virus vector expressing designer HIV-1 envelope glycoproteins to enhance humoral responses.
[38] A recombinant VSV-vectored MERS-CoV vaccine induces neutralizing antibody and T cell responses in rhesus monkeys after single dose immunization.
[39] Vesicular Stomatitis Virus-Vectored Multi-Antigen Tuberculosis Vaccine Limits Bacterial Proliferation in Mice following a Single Intranasal Dose.
[40] Major Concerns on the Identification of Bat Coronavirus Strain RaTG13 and Quality of Related Nature Paper.
[41] The Abnormal Nature of the Fecal Swab Sample used for NGS Analysis of RaTG13 Genome Sequence Imposes a Question on the Correctness of the RaTG13 Sequence
[42] SARS-CoV-2 and the secret of the furin site.
[43] Ivermectin for Prevention and Treatment of COVID-19 Infection: A Systematic Review, Meta-analysis, and Trial Sequential Analysis to Inform Clinical Guidelines.
[44] The potential for antibody-dependent enhancement of SARS-CoV-2 infection: Translational implications for vaccine development.
[45] Anti-Severe Acute Respiratory Syndrome Coronavirus Spike Antibodies Trigger Infection of Human Immune Cells via a pH- and Cysteine Protease-Independent FcγR Pathway.
[46] At the Intersection Between SARS-CoV-2, Macrophages and the Adaptive Immune Response: A Key Role for Antibody-Dependent Pathogenesis But Not Enhancement of Infection in COVID-19.
[47] Strictly regular use of ivermectin as prophylaxis for COVID-19 leads to a 90% reduction in COVID-19 mortality rate,...
[48] Why are we vaccinating children against COVID-19?
[49] Should we discount the laboratory origin of COVID-19?
[50] The genetic structure of SARS-CoV-2 does not rule out a laboratory origin.
[51] Chloroquine is a potent inhibitor of SARS coronavirus infection and spread.
[52] In vitro inhibition of severe acute respiratory syndrome coronavirus by chloroquine.
[53] Hydroxychloroquine: From Malaria to Autoimmunity.
[54] Evaluation of immunomodulators, interferons and known in vitro SARS-CoV inhibitors for inhibition of SARS-CoV replication in BALB/c mice.
[55] Hydroxychloroquine and Chloroquine Retinopathy. D.J. Browning.
[56] Structural basis of receptor recognition by SARS-CoV-2.
[57] Effect of High vs Low Doses of Chloroquine Diphosphate as Adjunctive Therapy for Patients Hospitalized With SARS-CoV-2 Infection. A Randomized Clinical Trial.
[58] Pre-trial questioning. One question being; Why were research subjects exposed to a lethal dose?

Suggestions for improvement can be made here.

Vaccine Adverse Effects.

The U.S. Government collects reports of adverse health events that follow the administration of a vaccine. The database of reported adverse events is called the VAERS (Vaccine Adverse Event Reporting System) database. The raw data can be downloaded from two sites, both of which present the data in ways designed to restrict your access to meaningful information. You can download the data from:

https://vaers.hhs.gov/data/datasets.html

Here the data has been split into three .csv files; 2021VAERSDATA.csv 2021VAERSSYMPTOMS.csv and 2021VAERSVAX.csv in a way that makes the data essentially useless, unless repackaged. This is deliberate.

The separate files make it very difficult to associate particular symptoms with particular vaccines. There are also problems where one file contradicts another, but this is not obvious as the data has been split. An example is; person 1033762 has "Death" listed among symptoms in 2021VAERSSYMPTOMS.csv but she is not listed as having died in 2021VAERSDATA.csv.

You can also download the data from here as a 767MB Microsoft Access database file. Offering a .mdb file restricts access to those having the necessary Microsoft software. The size of the file is also meant to put you off.

I have repackaged the three .csv files as a single text file. You can download it from here (data till 16 Dec. 2022; WinZip opens .gz files). I have only repackaged the data I thought important. I have not included the number of days from the vaccination date to the onset date, which can be calculated from the other data.

If you wish to browse the database go to https://medalerts.org/vaersdb/
You can also try https://wonder.cdc.gov/vaers.html

If you just wish a general summary of the data follow this link. N.B. This includes many foreign cases.

The following statistics report adverse reactions that have occurred within the United States, and have been recorded in the VAERS database. The under-reporting factor is unknown, but is likely to be high.

As of 16 Dec. 2022 there have been 15,615 deaths in the U.S. associated with the three vaccines given to Americans. We have:

U.S. DEATHS ASSOCIATED WITH COVID-19 VACCINES:
Date 09-0407-0504-0602-0730-0727-0824-0922-1019-1117-1214-0111-0211-0308-0406-0503-0601-0729-0726-0823-0921-1018-1116-12
Pfizer 11281673194222382480276632533671412343574620493853265679590160576204634864966652676769307069
Moderna 12461921221624842675286531693451376739514186450648235166536654985636580159476130624964916640
Janssen 72294393486542621746887102910971276136714751535156316001629165916801730176218031845
Total 246239084574523257246280719980448957944310121108531166812429128791320513522138621417914569148371528315615
MYOCARDITIS:
Date 09-0407-0504-0602-0730-0727-0824-0922-1019-1117-1214-0111-0211-0308-0406-0503-0601-0729-0726-0823-0921-1018-1116-12
Pfizer 236237173788096911391260133914271533164316961729175417721788180418191836184818661875
Moderna 3254212353421458534613674719789859876893908915924931935942963973984
Janssen 04132229344152626678838790919293949798100102104
PERICARDITIS:
Date 09-0407-0504-0602-0730-0727-0824-0922-1019-1117-1214-0111-0211-0308-0406-0503-0601-0729-0726-0823-0921-1018-1116-12
Pfizer 3869200420503559664766856910973102410531078109911191122113111471166118111921198
Moderna 3057150260311352404458515559601633660680699705710716722728735739747
Janssen 013223449576778889096100103107109111111111113115115116119
PULMONARY EMBOLISM:
Date 09-0407-0504-0602-0730-0727-0824-0922-1019-1117-1214-0111-0211-0308-0406-0503-0601-0729-0726-0823-0921-1018-1116-12
Pfizer 913106457528088999931080118612601340141714561493151915411557157415911601161016261636
Moderna 1073416637868599179861048110411621227129813391360137613941400141414271450146214711478
Janssen 11246339384408436469506546559577596617620625634636637641645646647652
THROMBOCYTOPENIA:
Date 09-0407-0504-0602-0730-0727-0824-0922-1019-1117-1214-0111-0211-0308-0406-0503-0601-0729-0726-0823-0921-1018-1116-12
Pfizer 66128247311355373397417458484513553579591599611618629633647655664673
Moderna 65120218269284299320334357367385404418430438448453460466471478482484
Janssen 992122137147152164184197205214219232235235237239240243245247249250

The above are monthly (28 day months) starting 9 April 2021. Weekly results can be found here. I was hoping that someone would use the weekly data to determine the extent of the throttling that has occurred.

The under-reporting factor has not been accurately determined. It has been estimated to be as low as 5 and as high as 40. This means that the numbers presented above need to be multiplied by this factor. Consequently, the numbers presented above are a huge under-estimate of the true number of adverse events.

As their Nov 26, 2021 "update", the evil VAERS people simply provided the Nov 19 data again. By "accident", of course.

The VAERS people delay all reports by one to two weeks (but some are delayed by months) so they can weed out those adverse events they feel are not directly related to the vaccines. Yet we have report 1180840 where the person involved died due to a traffic accident. How did this pass VAERS censorship? Clearly, the VAERS people have chosen to let the report stand. They may have even submitted the report themselves. They have done this for propaganda purposes. It has been done to stress that not all adverse events are actually caused by the vaccines, implying that you should heavily discount the numbers. However, they have already removed reports they feel are not directly related to the vaccines, so the numbers have already been heavily discounted. They do this to deceive you. That they delete hundreds of reports is clear from the numerous gaps in the VAERS ID. Actually, a lot of the gaps are due to foreign reports.

Other popular topics are:

Proof that Adolf Hitler was a double agent.
A few books on Religion and Mythology (Free Downloads).
A large collection of photos of Jewish political leaders wearing skullcaps, e.g., Nelson Mandela, Tony Blair, Gordon Brown, etc.
There are no ancient Jewish cities in Israel, but there are lots of ancient Greek cities.
WOW; Presidents Reagan, Clinton, Bush, Obama, Trump, and Biden are Jews.
Is it too late to save Florida from Drowning? The Conspiracy to hide Global Warming.
The free Operating System Linux running Microsoft Operating Systems on Virtual Computers (a DIY guide).
Proof that the name ADAM is of Greek origin.
preearth
 
Posts: 51
Joined: Tue Jun 08, 2010 5:52 am


Return to History

Who is online

Users browsing this forum: No registered users and 10 guests

cron